WormBase Tree Display for Expr_pattern: Expr5120
expand all nodes | collapse all nodes | view schema
Expr5120 | Expression_of | Gene | WBGene00015368 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015368 | ||
Homol | Homol_homol | C03A7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (5) | |||
Type | Reporter_gene | [srt-65::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGTACCTCCTTAGCTGTTTATCA] 3' and primer B 5' [AATTCGGTACGACCATAAAAA] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells in head; | ||
Larval Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells in head; | |||
Picture | WBPicture0000003635 | ||
WBPicture0000003636 | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
Strain: BC15345 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003936 |