WormBase Tree Display for Expr_pattern: Expr5120
expand all nodes | collapse all nodes | view schema
Expr5120 | Expression_of | Gene | WBGene00015368 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015368 | ||||
Homol | Homol_homol | C03A7:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005735 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [srt-65::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGTACCTCCTTAGCTGTTTATCA] 3' and primer B 5' [AATTCGGTACGACCATAAAAA] 3'. | |||
Pattern (2) | |||||
Picture | WBPicture0000003635 | ||||
WBPicture0000003636 | |||||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||||
Strain: BC15345 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003936 |