WormBase Tree Display for Variation: WBVar02123388
expand all nodes | collapse all nodes | view schema
WBVar02123388 | Name | Public_name | WBVar02123388 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854311 | |||||||
Sequence_details | SMap | S_parent | Sequence | T20G5 | ||||
Flanking_sequences | TGAAAGACATTTTCTTCCGGCTACAGTAGT | CTCGGTTGGCGAAATACCAGGTGGAAATTC | ||||||
Mapping_target | T20G5 | |||||||
Source_location | 225 | CHROMOSOME_III | 10200001 | 10218000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022852 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00022856 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004326 | ||||||
WBGene00011872 | ||||||||
WBGene00011871 | ||||||||
WBGene00011873 | ||||||||
WBGene00011867 | ||||||||
WBGene00011874 | ||||||||
WBGene00202069 | ||||||||
WBGene00000833 | ||||||||
WBGene00011868 | ||||||||
Transcript | T20G5.11.1 | |||||||
T20G5.4b.1 | ||||||||
T20G5.4a.1 | ||||||||
T20G5.1.1 | ||||||||
T20G5.9.1 | ||||||||
T20G5.13.1 | ||||||||
T20G5.17 | ||||||||
T20G5.10.1 | ||||||||
T20G5.2.1 | ||||||||
T20G5.12.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |