WormBase Tree Display for Variation: WBVar02122942
expand all nodes | collapse all nodes | view schema
WBVar02122942 | Name | Public_name | WBVar02122942 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853865 | |||||||
Sequence_details | SMap | S_parent | Sequence | K04C2 | ||||
Flanking_sequences | TACTGCACCCTTGCGATTGTTTGCAATTTT | CATGGAGTACGGTTAGATCACCGAGAAGTT | ||||||
Mapping_target | K04C2 | |||||||
Source_location | 225 | CHROMOSOME_III | 6885955 | 6899113 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023192 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00023099 | ||||||
WBGene00019382 | ||||||||
WBGene00023097 | ||||||||
WBGene00000265 | ||||||||
WBGene00200903 | ||||||||
WBGene00201979 | ||||||||
WBGene00019380 | ||||||||
WBGene00020315 | ||||||||
WBGene00023098 | ||||||||
WBGene00198939 | ||||||||
Transcript (12) | ||||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |