WormBase Tree Display for Variation: WBVar00323162
expand all nodes | collapse all nodes | view schema
| WBVar00323162 | Evidence | Paper_evidence | WBPaper00031335 | ||
|---|---|---|---|---|---|
| Name | Public_name | nDf54 | |||
| Other_name | T07D1.2a.1:c.38-1197_1294del | ||||
| HGVSg | CHROMOSOME_X:g.2430106_2436393del | ||||
| Sequence_details | SMap | S_parent | Sequence | T07D1 | |
| Flanking_sequences | CAACGATAGAAAAAAAATAAATTTAAAAATTTTTAAATTCTGAAATTAGT | AACTGATTGTGAGTAATTGTCATCTTTTGACAGTAAATAAAAAATTTTCA | |||
| Mapping_target | T07D1 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00027445 | ||||
| WBStrain00027525 | |||||
| WBStrain00027593 | |||||
| Laboratory | MT | ||||
| Status | Live | Curator_confirmed | WBPerson4025 | ||
| Affects | Gene | WBGene00003310 | |||
| WBGene00020301 | |||||
| WBGene00003309 | |||||
| Transcript | T07D1.6 | ||||
| T07D1.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
| VEP_impact | HIGH | ||||
| cDNA_position | ?-493 | ||||
| CDS_position | ?-493 | ||||
| Protein_position | ?-165 | ||||
| Intron_number | 1-2/2 | ||||
| Exon_number | 1-3/3 | ||||
| T07D1.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
| VEP_impact | HIGH | ||||
| cDNA_position | ?-1246 | ||||
| CDS_position | ?-1246 | ||||
| Protein_position | ?-416 | ||||
| Intron_number | 1-4/4 | ||||
| Exon_number | 1-5/5 | ||||
| T07D1.7 | |||||
| T07D1.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
| VEP_impact | HIGH | ||||
| HGVSc | T07D1.2a.1:c.38-1197_1294del | ||||
| cDNA_position | ?-1302 | ||||
| CDS_position | ?-1294 | ||||
| Protein_position | ?-432 | ||||
| Intron_number | 2-6/7 | ||||
| Exon_number | 3-7/8 | ||||
| Interactor | WBInteraction000542495 | ||||
| Genetics | Interpolated_map_position | X | -15.4844 | ||
| Description | Phenotype | WBPhenotype:0001171 | Paper_evidence | WBPaper00054795 | |
| Curator_confirmed | WBPerson143 | ||||
| Reference | WBPaper00031335 | ||||
| WBPaper00054795 | |||||
| Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf267793 | ||
| This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
| Method | Deletion_allele |
