WormBase Tree Display for Variation: WBVar00143953
expand all nodes | collapse all nodes | view schema
WBVar00143953 | Evidence | Person_evidence | WBPerson25803 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1376 | ||||||
Other_name | CE50691:p.Pro423GlnfsTer51 | |||||||
F25E2.5e.1:c.1511del | ||||||||
CE50852:p.Pro426GlnfsTer51 | ||||||||
CE26364:p.Pro439GlnfsTer51 | ||||||||
F25E2.5c.1:c.1316del | ||||||||
F25E2.5h.1:c.1268del | ||||||||
F25E2.5b.1:c.1520del | ||||||||
F25E2.5f.1:c.1502del | ||||||||
F25E2.5g.1:c.1277del | ||||||||
CE28003:p.Pro501GlnfsTer51 | ||||||||
CE30963:p.Pro507GlnfsTer51 | ||||||||
CE28002:p.Pro535GlnfsTer51 | ||||||||
CE50732:p.Pro504GlnfsTer51 | ||||||||
F25E2.5d.1:c.1613del | ||||||||
F25E2.5a.1:c.1604del | ||||||||
CE50706:p.Pro538GlnfsTer51 | ||||||||
HGVSg | CHROMOSOME_X:g.822069del | |||||||
Sequence_details | SMap | S_parent | Sequence | F25E2 | ||||
Flanking_sequences | ACCATACGTCCCAACAAGGCAGTCATCAAC | AGGGCACCAAGGTCAGGTACCGAATGATCC | ||||||
Mapping_target | F25E2 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004312 | |||||||
WBStrain00004377 | ||||||||
WBStrain00026945 | ||||||||
WBStrain00030757 | ||||||||
WBStrain00035151 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000899 | ||||||
Transcript | F25E2.5g.1 | VEP_consequence | frameshift_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F25E2.5g.1:c.1277del | |||||||
HGVSp | CE50852:p.Pro426GlnfsTer51 | |||||||
cDNA_position | 1277 | |||||||
CDS_position | 1277 | |||||||
Protein_position | 426 | |||||||
Exon_number | 5/12 | |||||||
Codon_change | cCa/ca | |||||||
Amino_acid_change | P/X | |||||||
F25E2.5d.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25E2.5d.1:c.1613del | |||||||
HGVSp | CE50706:p.Pro538GlnfsTer51 | |||||||
cDNA_position | 1613 | |||||||
CDS_position | 1613 | |||||||
Protein_position | 538 | |||||||
Exon_number | 8/15 | |||||||
Codon_change | cCa/ca | |||||||
Amino_acid_change | P/X | |||||||
F25E2.5e.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25E2.5e.1:c.1511del | |||||||
HGVSp | CE50732:p.Pro504GlnfsTer51 | |||||||
cDNA_position | 1560 | |||||||
CDS_position | 1511 | |||||||
Protein_position | 504 | |||||||
Exon_number | 8/16 | |||||||
Codon_change | cCa/ca | |||||||
Amino_acid_change | P/X | |||||||
F25E2.5b.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25E2.5b.1:c.1520del | |||||||
HGVSp | CE30963:p.Pro507GlnfsTer51 | |||||||
cDNA_position | 1567 | |||||||
CDS_position | 1520 | |||||||
Protein_position | 507 | |||||||
Exon_number | 8/16 | |||||||
Codon_change | cCa/ca | |||||||
Amino_acid_change | P/X | |||||||
F25E2.5f.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25E2.5f.1:c.1502del | |||||||
HGVSp | CE28003:p.Pro501GlnfsTer51 | |||||||
cDNA_position | 1550 | |||||||
CDS_position | 1502 | |||||||
Protein_position | 501 | |||||||
Exon_number | 8/16 | |||||||
Codon_change | cCa/ca | |||||||
Amino_acid_change | P/X | |||||||
F25E2.5a.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25E2.5a.1:c.1604del | |||||||
HGVSp | CE28002:p.Pro535GlnfsTer51 | |||||||
cDNA_position | 1653 | |||||||
CDS_position | 1604 | |||||||
Protein_position | 535 | |||||||
Exon_number | 9/17 | |||||||
Codon_change | cCa/ca | |||||||
Amino_acid_change | P/X | |||||||
F25E2.5c.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25E2.5c.1:c.1316del | |||||||
HGVSp | CE26364:p.Pro439GlnfsTer51 | |||||||
cDNA_position | 1321 | |||||||
CDS_position | 1316 | |||||||
Protein_position | 439 | |||||||
Exon_number | 6/14 | |||||||
Codon_change | cCa/ca | |||||||
Amino_acid_change | P/X | |||||||
F25E2.5h.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25E2.5h.1:c.1268del | |||||||
HGVSp | CE50691:p.Pro423GlnfsTer51 | |||||||
cDNA_position | 1268 | |||||||
CDS_position | 1268 | |||||||
Protein_position | 423 | |||||||
Exon_number | 5/12 | |||||||
Codon_change | cCa/ca | |||||||
Amino_acid_change | P/X | |||||||
Interactor | WBInteraction000051076 | |||||||
WBInteraction000051077 | ||||||||
WBInteraction000051078 | ||||||||
WBInteraction000051079 | ||||||||
WBInteraction000051080 | ||||||||
WBInteraction000051081 | ||||||||
WBInteraction000051082 | ||||||||
WBInteraction000051083 | ||||||||
WBInteraction000051084 | ||||||||
WBInteraction000051085 | ||||||||
WBInteraction000051086 | ||||||||
WBInteraction000051087 | ||||||||
WBInteraction000051088 | ||||||||
WBInteraction000051089 | ||||||||
WBInteraction000051090 | ||||||||
WBInteraction000051091 | ||||||||
WBInteraction000051092 | ||||||||
WBInteraction000051093 | ||||||||
WBInteraction000051094 | ||||||||
WBInteraction000051095 | ||||||||
WBInteraction000051096 | ||||||||
WBInteraction000051097 | ||||||||
WBInteraction000051098 | ||||||||
WBInteraction000051099 | ||||||||
WBInteraction000051100 | ||||||||
WBInteraction000051101 | ||||||||
WBInteraction000051102 | ||||||||
WBInteraction000051103 | ||||||||
WBInteraction000051104 | ||||||||
WBInteraction000051105 | ||||||||
WBInteraction000051106 | ||||||||
WBInteraction000051107 | ||||||||
WBInteraction000051108 | ||||||||
WBInteraction000051109 | ||||||||
WBInteraction000051110 | ||||||||
WBInteraction000051111 | ||||||||
WBInteraction000051112 | ||||||||
WBInteraction000051113 | ||||||||
WBInteraction000051114 | ||||||||
WBInteraction000051115 | ||||||||
WBInteraction000051116 | ||||||||
WBInteraction000051117 | ||||||||
WBInteraction000051118 | ||||||||
WBInteraction000051119 | ||||||||
WBInteraction000051120 | ||||||||
WBInteraction000051121 | ||||||||
WBInteraction000052359 | ||||||||
WBInteraction000052361 | ||||||||
WBInteraction000052362 | ||||||||
WBInteraction000052446 | ||||||||
WBInteraction000052447 | ||||||||
WBInteraction000052449 | ||||||||
WBInteraction000052451 | ||||||||
WBInteraction000052453 | ||||||||
WBInteraction000052455 | ||||||||
WBInteraction000518469 | ||||||||
WBInteraction000523951 | ||||||||
WBInteraction000536042 | ||||||||
WBInteraction000536053 | ||||||||
Genetics | Interpolated_map_position | X | -19.4991 | |||||
Mapping_data | In_2_point | 299 | ||||||
413 | ||||||||
414 | ||||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000316 | ||||
WBPaper00000504 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | defective dauer formation | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00038374 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "When compared to the daf-2(e1370) parental strain, daf-2(e1370); daf-3(mgDf90) mutants lived significantly longer. This was also observed in daf-2(e1370); daf-3(e1376) worms, which is a weaker allele of daf-3." (see Figure 4A) | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00038374 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | daf-8 and daf-7 transcripts were upregulated in daf-3 mutants. However, lag-2 expression was not significantly changed in daf-3 mutants | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | qRT-PCR | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000542 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00038374 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | daf-3(e1376) enhances the constitutive dauer formation phenotype of daf-2(e1370) (Figure S11A, S11C) | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00038374 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001692 | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals did not display the L2 M37 epitope to the same extent as wildtype when grown in the presence of pheromone, e.g. animals were ILD defective. | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002285 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002292 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002299 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002319 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002323 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002344 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000061 | Paper_evidence | WBPaper00005086 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00005086 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000256 | Paper_evidence | WBPaper00000316 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00032073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The expression of cuIs5 (or cuIs2), a reporter of TGF-beta -signaling activity, remains at wild type levels. | Paper_evidence | WBPaper00032073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | cuIs5 or cuIs2 | Paper_evidence | WBPaper00032073 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000316 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000660 | Paper_evidence | WBPaper00005511 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | daf-3 mutants do not aggregate and border on food | Paper_evidence | WBPaper00005511 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The mitotic region of daf-3(e1376) was indistinguishable from that of the wild type | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001040 | Paper_evidence | WBPaper00000316 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were positive for mAb M37 at the L1 stage but not at any other stage, similar to N2 animals. | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Low | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 27.5 | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was normal (like wild type) in daf-3(e1376) mutants, resulting in the same number of animals crossing the copper barrier to get to the diacetyl spot compared to wild type controls (Figure 5) | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBMol:00002862 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00037970 | |||||||
WBPaper00038374 | ||||||||
WBPaper00043908 | ||||||||
WBPaper00000504 | ||||||||
WBPaper00000932 | ||||||||
WBPaper00014521 | ||||||||
WBPaper00002589 | ||||||||
WBPaper00005086 | ||||||||
WBPaper00021876 | ||||||||
WBPaper00000316 | ||||||||
WBPaper00015224 | ||||||||
WBPaper00016006 | ||||||||
WBPaper00032073 | ||||||||
WBPaper00005511 | ||||||||
WBPaper00035610 | ||||||||
WBPaper00016610 | ||||||||
WBPaper00045859 | ||||||||
Method | Deletion_allele |