WormBase Tree Display for Variation: WBVar00143953
expand all nodes | collapse all nodes | view schema
WBVar00143953 | Evidence | Person_evidence | WBPerson25803 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1376 | ||||||
Other_name (16) | ||||||||
HGVSg | CHROMOSOME_X:g.822069del | |||||||
Sequence_details | SMap | S_parent | Sequence | F25E2 | ||||
Flanking_sequences | ACCATACGTCCCAACAAGGCAGTCATCAAC | AGGGCACCAAGGTCAGGTACCGAATGATCC | ||||||
Mapping_target | F25E2 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004312 | |||||||
WBStrain00004377 | ||||||||
WBStrain00026945 | ||||||||
WBStrain00030757 | ||||||||
WBStrain00035151 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | X | -19.4991 | |||||
Mapping_data | In_2_point | 299 | ||||||
413 | ||||||||
414 | ||||||||
Description | Phenotype (17) | |||||||
Phenotype_not_observed | WBPhenotype:0000061 | Paper_evidence | WBPaper00005086 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00005086 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000256 | Paper_evidence | WBPaper00000316 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00032073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The expression of cuIs5 (or cuIs2), a reporter of TGF-beta -signaling activity, remains at wild type levels. | Paper_evidence | WBPaper00032073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | cuIs5 or cuIs2 | Paper_evidence | WBPaper00032073 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000316 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000660 | Paper_evidence | WBPaper00005511 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | daf-3 mutants do not aggregate and border on food | Paper_evidence | WBPaper00005511 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The mitotic region of daf-3(e1376) was indistinguishable from that of the wild type | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001040 | Paper_evidence | WBPaper00000316 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were positive for mAb M37 at the L1 stage but not at any other stage, similar to N2 animals. | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Low | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 27.5 | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was normal (like wild type) in daf-3(e1376) mutants, resulting in the same number of animals crossing the copper barrier to get to the diacetyl spot compared to wild type controls (Figure 5) | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBMol:00002862 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (17) | ||||||||
Method | Deletion_allele |