WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e61 | ||||||
Other_name | e61sd | |||||||
F27C1.8.1:c.607G>T | ||||||||
CE09720:p.Gly203Ter | ||||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | ||||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | ||||||
Mapping_target | F27C1 | |||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (325) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001067 | ||||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F27C1.8.1:c.607G>T | |||||||
HGVSp | CE09720:p.Gly203Ter | |||||||
cDNA_position | 607 | |||||||
CDS_position | 607 | |||||||
Protein_position | 203 | |||||||
Exon_number | 1/1 | |||||||
Codon_change | Gga/Tga | |||||||
Amino_acid_change | G/* | |||||||
Interactor | WBInteraction000052055 | |||||||
WBInteraction000052058 | ||||||||
WBInteraction000501358 | ||||||||
WBInteraction000501364 | ||||||||
WBInteraction000519055 | ||||||||
WBInteraction000537293 | ||||||||
WBInteraction000537294 | ||||||||
Genetics (2) | ||||||||
Description | Phenotype | WBPhenotype:0000072 | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | |||||||
Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | ||||
Curator_confirmed | WBPerson3900 | |||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "This ability of a mutation in one collagen to affect others was further confirmed for the non-stage-specific collagen DPY-7, after costaining of the TP14:dpy-5(e61)I;kaIs12(col-19::gfp) strain with the DPY-7 monoclonal antibodies (Fig. 3C, red). In the dorsal/ventral hypodermal cells, DPY-7 localized in a regular but constricted pattern that corresponded to the annular furrows (Fig. 3C, denoted an) and was similar to the COL-19::GFP patterns observed in wild-type and in dpy-5 mutants. Conversely, in the matrix overlying the lateral seam cell cords, DPY-7 expression was abnormal: the DPY-7 staining pattern appeared broken (Fig. 3C, denoted by double-headed arrow) and generally deviated from the wildtype staining pattern in which both annuli (COL-19) and annular furrows (DPY-7) normally extend to appose the lateral ala (Fig. 1C)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000583 | Paper_evidence (2) | |||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPerson2987 | ||||||||
Remark | strong dumpy; early larvae non-dumpy; e61/+ is very slightly dumpy | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Authors report "strong dpy" (Table 1); "It is interesting to note that the annuli overlying the ventral and dorsal hypodermis are present but differ markedly from wild-type nematodes (Fig. 1E, double-headed arrows) in that they do not oppose the lateral alae (Fig. 3A,E, double-headed arrows). As a result, the cuticle above the lateral hypodermal seam cell cords, having failed to contract normally, is extended, and this results in the characteristic Dpy phenotype." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Semi_dominant | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "In some areas corresponding to the seam cell cords, large vesicles are evident and the tagged protein is found concentrated at the periphery of these structures (Fig. 3D), perhaps indicating a failure in the complete secretion of COL-19::GFP." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "When the strain TP14:dpy-5(e61) I;kaIs12(col-19::gfp), resulting from crossing TP12:kaIs(col-19::gfp) with the dpy-5(e61) mutant, was examined under epifluorescence, the ala, apparent by means of Nomarski imaging (Fig. 3E), were shown to express COL-19::GFP in a variable manner (Fig. 3B, arrowed). In addition, two distinct regions became apparent: a region overlying the dorsal/ventral hypodermal cells, which showed annuli fluorescing as distinct bands as observed in wildtype TP12:kaIs(col-19::gfp) worms (Fig. 3B-D, denoted an), and a second, extended region of disruption overlying the seam cell cords (Fig. 3B-D, double-headed arrows)... The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)... These data show that mutation of the DPY-5 collagen in these nematodes is sufficient to alter the expression patterns of the COL-19::GFP collagen." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1); "The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1); "The disrupted region did not have the characteristic annuli and instead appeared featureless when viewed by Nomarski microscopy (Fig. 3E, double-headed arrow). The regular annular fluorescence did appear more closely packed than in wildtype nematodes (Fig. 3B-D, denoted an), having a periodicity of approximately 0.75 μm compared with 1.2 μm, respectively, an observation consistent with the shorter length of these adult nematodes." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00053771 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Hypersensitive to the reactive small molecule and prooxidant juglone. | Paper_evidence | WBPaper00053771 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed (6) | ||||||||
Reference (45) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |