WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||
Mapping_target | F27C1 | ||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (325) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001067 | |||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F27C1.8.1:c.607G>T | ||||||
HGVSp | CE09720:p.Gly203Ter | ||||||
cDNA_position | 607 | ||||||
CDS_position | 607 | ||||||
Protein_position | 203 | ||||||
Exon_number | 1/1 | ||||||
Codon_change | Gga/Tga | ||||||
Amino_acid_change | G/* | ||||||
Interactor | WBInteraction000052055 | ||||||
WBInteraction000052058 | |||||||
WBInteraction000501358 | |||||||
WBInteraction000501364 | |||||||
WBInteraction000519055 | |||||||
WBInteraction000537293 | |||||||
WBInteraction000537294 | |||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||
Mapping_data | In_2_point (165) | ||||||
In_multi_point (349) | |||||||
In_pos_neg_data (72) | |||||||
Description (2) | |||||||
Reference (45) | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |