WormBase Tree Display for Variation: WBVar00092079
expand all nodes | collapse all nodes | view schema
WBVar00092079 | Evidence | Paper_evidence | WBPaper00024285 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok799 | |||||||
HGVSg | |||||||||
Sequence_details | SMap | S_parent | Sequence | C41C4 | |||||
Flanking_sequences | caactggactattgtcttcttctttctcta | cgtcttcctgtcggctctcgaatacctctg | |||||||
Mapping_target | C41C4 | ||||||||
Type_of_mutation | Insertion | AGTTGTAGTTTCTTAAGTATTTGTGTGTTTCTTAGATAAGAGTTAGTGATTTTCCCTGTCTTTGTCNCAATATATATTGAAAAAAAACTGAGAGATTTTTCGACGTGGTTTGTTCCTTTTTTTGTTGCGCTTATGGTATTAGCGATTCAAAAAATTCAAAAAAAAATTCAAAAAAGTTTAATAGAAGGTATTATAGTTCTAAACAGAAATATAAATTATTGGAAAATTTATAATAATCCATTGAGCTTTTAAATTGCTTCAAGACAATTTTCACCAAAAATAATCTACGAAACATTTTTCAATCGATTTTTCAAACTTTTACAAAATATATATTTCTTTGATTTTTTCTAGCGAGGACTTCGTGTTGTTCAGTTGAACCCAGTAGCTTCACAAATGCTATTGGTAATTT | |||||||
Deletion | |||||||||
PCR_product | ok799_external | ||||||||
ok799_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031637 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002147 | |||||||
Transcript | C41C4.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-1357 | ||||||||
CDS_position | ?-1357 | ||||||||
Protein_position | ?-453 | ||||||||
Intron_number | 1-2/4 | ||||||||
Exon_number | 1-3/5 | ||||||||
C41C4.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-2453 | ||||||||
CDS_position | ?-2383 | ||||||||
Protein_position | ?-795 | ||||||||
Intron_number | 6-8/11 | ||||||||
Exon_number | 7-9/12 | ||||||||
Interactor | WBInteraction000501557 | ||||||||
WBInteraction000520494 | |||||||||
WBInteraction000525372 | |||||||||
WBInteraction000525373 | |||||||||
WBInteraction000537511 | |||||||||
WBInteraction000541685 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000081 | Paper_evidence | WBPaper00049705 | |||||
Curator_confirmed | WBPerson34124 | ||||||||
Remark | reduced recovery after prolonged L1 arrest | Paper_evidence | WBPaper00049705 | ||||||
Curator_confirmed | WBPerson34124 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00024285 | |||||||
WBPaper00046107 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson10038 | |||||||||
Remark | Mutations in components of the UPR result in GLR-1::GFP accumulation in the cell body. | Paper_evidence | WBPaper00024285 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
From the text: "However, when the glr-1 promoter was used to drive neuronal unc-6 gene expression in unc-6; ire-1 and unc-6; xbp-1 double mutants, UNC-6 was observed only in cell bodies (Fig. 2F, H)." | Paper_evidence | WBPaper00046107 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
From the text: "in ire-1 mutants, Venus::UNC-6 was abnormally localized to the perinuclear region with minimal detection in the axon (Fig. 1D, E). The perinuclear accumulation of Venus::UNC-6 was colocalized with the ER marker (Fig. 1P-R, Rollset al.2002). These results suggest that IRE-1 is required for UNC-6's transport from the ER." | Paper_evidence | WBPaper00046107 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Genotype | unc-6(ev400); [ghEx15(glr-1p::unc-6::Venus; tph-1p::GFP)] | Paper_evidence | WBPaper00046107 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
ghIs9[unc-6p::Venus::unc-6; str-3p::dsRed2] IV | Paper_evidence | WBPaper00046107 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001834 | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "All three ire-1 alleles failed to produce detectable levels of spliced XBP-1 under normal conditions or after an HP incubation (Fig. 6D and E)." | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002199 | Paper_evidence | WBPaper00052970 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Quoted from paper, "Neither wild-type animals nor UPRmt deficient ubl-5 mutants exhibited abnormal post-deprivation activity. When UPRER deficient ire-1 mutants were deprived, their mean number of vm twitches increased by 30%, mirroring the trend reported for HSN deficient animals (Fig. 8c)." vm = vulval muscle | Paper_evidence | WBPaper00052970 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005821 | PATO:0000460 | Paper_evidence | WBPaper00052970 | ||||
Curator_confirmed | WBPerson10038 | ||||||||
GO_term | GO:0030431 | PATO:0000460 | Paper_evidence | WBPaper00052970 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Tunicamycin (Tm) preconditioning in wild type worms leads to increased tolerance to hypoxia. "... three loss-of-function mutant alleles of ire-1 (Fig. 3B), two alleles of atf-6 (Fig. 3D), and an allele of xbp-1 (Fig. 3F) all were defective for Tm preconditioning (Fig. 2D)." | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"HP (hypoxic preconditioning) consistently provided protection from subsequent harsh hypoxic exposure for wild-type animals (Fig. 4A and B)... Two ire-1 alleles (v33 and ok799) blocked HP (Fig. 4C);" | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000384 | Paper_evidence | WBPaper00046107 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | From the text: "ire-1 mutants did not show significant axon guidance defects (Fig. S3C in Supporting Information). UNC-6 secreted by muscles and other tissues probably compensates for the neuronal dysfunction of UNC-6 in ire-1 mutants." | Paper_evidence | WBPaper00046107 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00046107 | ||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Genotype | zdIs5(mec-4::GFP) I | Paper_evidence | WBPaper00046107 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00049307 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutation of the ER-UPR genes ire-1 and xbp-1 did not suppress Neuro-Nmnat1(gcIs30[Neuro-m-nonN-Nmnat1]) hypoxic survival." (Figure S3b) | Paper_evidence | WBPaper00049307 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0001666 | PATO:0000460 | Paper_evidence | WBPaper00049307 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | gcIs30 [Neuro-m-nonN-Nmnat1] | Paper_evidence | WBPaper00049307 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (8) | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |