WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||||
Mapping_target | F27C1 | ||||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (325) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001067 | |||||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F27C1.8.1:c.607G>T | ||||||||
HGVSp | CE09720:p.Gly203Ter | ||||||||
cDNA_position | 607 | ||||||||
CDS_position | 607 | ||||||||
Protein_position | 203 | ||||||||
Exon_number | 1/1 | ||||||||
Codon_change | Gga/Tga | ||||||||
Amino_acid_change | G/* | ||||||||
Interactor | WBInteraction000052055 | ||||||||
WBInteraction000052058 | |||||||||
WBInteraction000501358 | |||||||||
WBInteraction000501364 | |||||||||
WBInteraction000519055 | |||||||||
WBInteraction000537293 | |||||||||
WBInteraction000537294 | |||||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||||
Mapping_data | In_2_point (165) | ||||||||
In_multi_point | 2 | ||||||||
3 | |||||||||
4 | |||||||||
5 | |||||||||
6 | |||||||||
9 | |||||||||
10 | |||||||||
11 | |||||||||
12 | |||||||||
13 | |||||||||
14 | |||||||||
15 | |||||||||
17 | |||||||||
20 | |||||||||
21 | |||||||||
22 | |||||||||
23 | |||||||||
24 | |||||||||
27 | |||||||||
30 | |||||||||
31 | |||||||||
32 | |||||||||
33 | |||||||||
34 | |||||||||
35 | |||||||||
36 | |||||||||
37 | |||||||||
42 | |||||||||
43 | |||||||||
44 | |||||||||
197 | |||||||||
198 | |||||||||
199 | |||||||||
200 | |||||||||
201 | |||||||||
202 | |||||||||
204 | |||||||||
205 | |||||||||
231 | |||||||||
232 | |||||||||
233 | |||||||||
234 | |||||||||
235 | |||||||||
236 | |||||||||
238 | |||||||||
239 | |||||||||
240 | |||||||||
241 | |||||||||
243 | |||||||||
244 | |||||||||
245 | |||||||||
248 | |||||||||
250 | |||||||||
270 | |||||||||
271 | |||||||||
272 | |||||||||
289 | |||||||||
306 | |||||||||
308 | |||||||||
309 | |||||||||
310 | |||||||||
311 | |||||||||
312 | |||||||||
327 | |||||||||
328 | |||||||||
335 | |||||||||
336 | |||||||||
343 | |||||||||
344 | |||||||||
350 | |||||||||
360 | |||||||||
361 | |||||||||
364 | |||||||||
365 | |||||||||
372 | |||||||||
373 | |||||||||
380 | |||||||||
381 | |||||||||
391 | |||||||||
396 | |||||||||
397 | |||||||||
398 | |||||||||
399 | |||||||||
400 | |||||||||
401 | |||||||||
402 | |||||||||
403 | |||||||||
414 | |||||||||
420 | |||||||||
452 | |||||||||
454 | |||||||||
499 | |||||||||
505 | |||||||||
510 | |||||||||
511 | |||||||||
512 | |||||||||
515 | |||||||||
517 | |||||||||
518 | |||||||||
527 | |||||||||
538 | |||||||||
566 | |||||||||
567 | |||||||||
572 | |||||||||
573 | |||||||||
574 | |||||||||
575 | |||||||||
576 | |||||||||
604 | |||||||||
634 | |||||||||
635 | |||||||||
636 | |||||||||
637 | |||||||||
638 | |||||||||
639 | |||||||||
640 | |||||||||
693 | |||||||||
694 | |||||||||
696 | |||||||||
697 | |||||||||
719 | |||||||||
720 | |||||||||
734 | |||||||||
813 | |||||||||
815 | |||||||||
958 | |||||||||
959 | |||||||||
963 | |||||||||
964 | |||||||||
965 | |||||||||
966 | |||||||||
967 | |||||||||
968 | |||||||||
969 | |||||||||
970 | |||||||||
973 | |||||||||
974 | |||||||||
977 | |||||||||
980 | |||||||||
983 | |||||||||
985 | |||||||||
986 | |||||||||
988 | |||||||||
989 | |||||||||
990 | |||||||||
991 | |||||||||
992 | |||||||||
997 | |||||||||
998 | |||||||||
1004 | |||||||||
1005 | |||||||||
1006 | |||||||||
1007 | |||||||||
1008 | |||||||||
1009 | |||||||||
1010 | |||||||||
1011 | |||||||||
1012 | |||||||||
1013 | |||||||||
1014 | |||||||||
1015 | |||||||||
1016 | |||||||||
1017 | |||||||||
1018 | |||||||||
1019 | |||||||||
1020 | |||||||||
1021 | |||||||||
1022 | |||||||||
1023 | |||||||||
1024 | |||||||||
1025 | |||||||||
1026 | |||||||||
1027 | |||||||||
1028 | |||||||||
1029 | |||||||||
1030 | |||||||||
1031 | |||||||||
1032 | |||||||||
1033 | |||||||||
1034 | |||||||||
1035 | |||||||||
1036 | |||||||||
1037 | |||||||||
1038 | |||||||||
1039 | |||||||||
1040 | |||||||||
1041 | |||||||||
1042 | |||||||||
1043 | |||||||||
1044 | |||||||||
1045 | |||||||||
1046 | |||||||||
1047 | |||||||||
1048 | |||||||||
1049 | |||||||||
1050 | |||||||||
1051 | |||||||||
1064 | |||||||||
1219 | |||||||||
1222 | |||||||||
1224 | |||||||||
1225 | |||||||||
1226 | |||||||||
1230 | |||||||||
1288 | |||||||||
1289 | |||||||||
1290 | |||||||||
1291 | |||||||||
1293 | |||||||||
1370 | |||||||||
1371 | |||||||||
1374 | |||||||||
1376 | |||||||||
1386 | |||||||||
1445 | |||||||||
1446 | |||||||||
1448 | |||||||||
1450 | |||||||||
1453 | |||||||||
1454 | |||||||||
1456 | |||||||||
1461 | |||||||||
1465 | |||||||||
1479 | |||||||||
1480 | |||||||||
1481 | |||||||||
1678 | |||||||||
1679 | |||||||||
1680 | |||||||||
1682 | |||||||||
1683 | |||||||||
1684 | |||||||||
1685 | |||||||||
1686 | |||||||||
1687 | |||||||||
1689 | |||||||||
1690 | |||||||||
1695 | |||||||||
1698 | |||||||||
1759 | |||||||||
1761 | |||||||||
1763 | |||||||||
1782 | |||||||||
1783 | |||||||||
1787 | |||||||||
1788 | |||||||||
1825 | |||||||||
1826 | |||||||||
1828 | |||||||||
1871 | |||||||||
1891 | |||||||||
1896 | |||||||||
1897 | |||||||||
1902 | |||||||||
2001 | |||||||||
2034 | |||||||||
2040 | |||||||||
2041 | |||||||||
2091 | |||||||||
2092 | |||||||||
2093 | |||||||||
2094 | |||||||||
2095 | |||||||||
2096 | |||||||||
2097 | |||||||||
2131 | |||||||||
2139 | |||||||||
2141 | |||||||||
2142 | |||||||||
2143 | |||||||||
2144 | |||||||||
2145 | |||||||||
2146 | |||||||||
2147 | |||||||||
2148 | |||||||||
2149 | |||||||||
2150 | |||||||||
2218 | |||||||||
2220 | |||||||||
2278 | |||||||||
2279 | |||||||||
2280 | |||||||||
2285 | |||||||||
2330 | |||||||||
2332 | |||||||||
2333 | |||||||||
2410 | |||||||||
2426 | |||||||||
2427 | |||||||||
2444 | |||||||||
2447 | |||||||||
2456 | |||||||||
2457 | |||||||||
2466 | |||||||||
2477 | |||||||||
2710 | |||||||||
2767 | |||||||||
2768 | |||||||||
2769 | |||||||||
2784 | |||||||||
3000 | |||||||||
3001 | |||||||||
3002 | |||||||||
3003 | |||||||||
3008 | |||||||||
3010 | |||||||||
3020 | |||||||||
3021 | |||||||||
3022 | |||||||||
3030 | |||||||||
3035 | |||||||||
3036 | |||||||||
3037 | |||||||||
3038 | |||||||||
3039 | |||||||||
3040 | |||||||||
3042 | |||||||||
3043 | |||||||||
3044 | |||||||||
3046 | |||||||||
3105 | |||||||||
3106 | |||||||||
3107 | |||||||||
3115 | |||||||||
3116 | |||||||||
3117 | |||||||||
3118 | |||||||||
3119 | |||||||||
3143 | |||||||||
3144 | |||||||||
3193 | |||||||||
3194 | |||||||||
3227 | |||||||||
3230 | |||||||||
3234 | |||||||||
3254 | |||||||||
3307 | |||||||||
3308 | |||||||||
3309 | |||||||||
3310 | |||||||||
3311 | |||||||||
3375 | |||||||||
3380 | |||||||||
3434 | |||||||||
3435 | |||||||||
3436 | |||||||||
5458 | |||||||||
5459 | |||||||||
5471 | |||||||||
In_pos_neg_data (72) | |||||||||
Description | Phenotype | WBPhenotype:0000072 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | |||||||
Curator_confirmed | WBPerson3900 | ||||||||
Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "This ability of a mutation in one collagen to affect others was further confirmed for the non-stage-specific collagen DPY-7, after costaining of the TP14:dpy-5(e61)I;kaIs12(col-19::gfp) strain with the DPY-7 monoclonal antibodies (Fig. 3C, red). In the dorsal/ventral hypodermal cells, DPY-7 localized in a regular but constricted pattern that corresponded to the annular furrows (Fig. 3C, denoted an) and was similar to the COL-19::GFP patterns observed in wild-type and in dpy-5 mutants. Conversely, in the matrix overlying the lateral seam cell cords, DPY-7 expression was abnormal: the DPY-7 staining pattern appeared broken (Fig. 3C, denoted by double-headed arrow) and generally deviated from the wildtype staining pattern in which both annuli (COL-19) and annular furrows (DPY-7) normally extend to appose the lateral ala (Fig. 1C)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000583 | Paper_evidence (2) | ||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark | strong dumpy; early larvae non-dumpy; e61/+ is very slightly dumpy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Authors report "strong dpy" (Table 1); "It is interesting to note that the annuli overlying the ventral and dorsal hypodermis are present but differ markedly from wild-type nematodes (Fig. 1E, double-headed arrows) in that they do not oppose the lateral alae (Fig. 3A,E, double-headed arrows). As a result, the cuticle above the lateral hypodermal seam cell cords, having failed to contract normally, is extended, and this results in the characteristic Dpy phenotype." | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In some areas corresponding to the seam cell cords, large vesicles are evident and the tagged protein is found concentrated at the periphery of these structures (Fig. 3D), perhaps indicating a failure in the complete secretion of COL-19::GFP." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "When the strain TP14:dpy-5(e61) I;kaIs12(col-19::gfp), resulting from crossing TP12:kaIs(col-19::gfp) with the dpy-5(e61) mutant, was examined under epifluorescence, the ala, apparent by means of Nomarski imaging (Fig. 3E), were shown to express COL-19::GFP in a variable manner (Fig. 3B, arrowed). In addition, two distinct regions became apparent: a region overlying the dorsal/ventral hypodermal cells, which showed annuli fluorescing as distinct bands as observed in wildtype TP12:kaIs(col-19::gfp) worms (Fig. 3B-D, denoted an), and a second, extended region of disruption overlying the seam cell cords (Fig. 3B-D, double-headed arrows)... The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)... These data show that mutation of the DPY-5 collagen in these nematodes is sufficient to alter the expression patterns of the COL-19::GFP collagen." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1); "The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1); "The disrupted region did not have the characteristic annuli and instead appeared featureless when viewed by Nomarski microscopy (Fig. 3E, double-headed arrow). The regular annular fluorescence did appear more closely packed than in wildtype nematodes (Fig. 3B-D, denoted an), having a periodicity of approximately 0.75 μm compared with 1.2 μm, respectively, an observation consistent with the shorter length of these adult nematodes." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00053771 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Hypersensitive to the reactive small molecule and prooxidant juglone. | Paper_evidence | WBPaper00053771 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (45) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |