WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e61 | |||||
Other_name | e61sd | ||||||
F27C1.8.1:c.607G>T | |||||||
CE09720:p.Gly203Ter | |||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||
Mapping_target | F27C1 | ||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (325) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001067 | |||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F27C1.8.1:c.607G>T | ||||||
HGVSp | CE09720:p.Gly203Ter | ||||||
cDNA_position | 607 | ||||||
CDS_position | 607 | ||||||
Protein_position | 203 | ||||||
Exon_number | 1/1 | ||||||
Codon_change | Gga/Tga | ||||||
Amino_acid_change | G/* | ||||||
Interactor | WBInteraction000052055 | ||||||
WBInteraction000052058 | |||||||
WBInteraction000501358 | |||||||
WBInteraction000501364 | |||||||
WBInteraction000519055 | |||||||
WBInteraction000537293 | |||||||
WBInteraction000537294 | |||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||
Mapping_data | In_2_point (165) | ||||||
In_multi_point | 2 | ||||||
3 | |||||||
4 | |||||||
5 | |||||||
6 | |||||||
9 | |||||||
10 | |||||||
11 | |||||||
12 | |||||||
13 | |||||||
14 | |||||||
15 | |||||||
17 | |||||||
20 | |||||||
21 | |||||||
22 | |||||||
23 | |||||||
24 | |||||||
27 | |||||||
30 | |||||||
31 | |||||||
32 | |||||||
33 | |||||||
34 | |||||||
35 | |||||||
36 | |||||||
37 | |||||||
42 | |||||||
43 | |||||||
44 | |||||||
197 | |||||||
198 | |||||||
199 | |||||||
200 | |||||||
201 | |||||||
202 | |||||||
204 | |||||||
205 | |||||||
231 | |||||||
232 | |||||||
233 | |||||||
234 | |||||||
235 | |||||||
236 | |||||||
238 | |||||||
239 | |||||||
240 | |||||||
241 | |||||||
243 | |||||||
244 | |||||||
245 | |||||||
248 | |||||||
250 | |||||||
270 | |||||||
271 | |||||||
272 | |||||||
289 | |||||||
306 | |||||||
308 | |||||||
309 | |||||||
310 | |||||||
311 | |||||||
312 | |||||||
327 | |||||||
328 | |||||||
335 | |||||||
336 | |||||||
343 | |||||||
344 | |||||||
350 | |||||||
360 | |||||||
361 | |||||||
364 | |||||||
365 | |||||||
372 | |||||||
373 | |||||||
380 | |||||||
381 | |||||||
391 | |||||||
396 | |||||||
397 | |||||||
398 | |||||||
399 | |||||||
400 | |||||||
401 | |||||||
402 | |||||||
403 | |||||||
414 | |||||||
420 | |||||||
452 | |||||||
454 | |||||||
499 | |||||||
505 | |||||||
510 | |||||||
511 | |||||||
512 | |||||||
515 | |||||||
517 | |||||||
518 | |||||||
527 | |||||||
538 | |||||||
566 | |||||||
567 | |||||||
572 | |||||||
573 | |||||||
574 | |||||||
575 | |||||||
576 | |||||||
604 | |||||||
634 | |||||||
635 | |||||||
636 | |||||||
637 | |||||||
638 | |||||||
639 | |||||||
640 | |||||||
693 | |||||||
694 | |||||||
696 | |||||||
697 | |||||||
719 | |||||||
720 | |||||||
734 | |||||||
813 | |||||||
815 | |||||||
958 | |||||||
959 | |||||||
963 | |||||||
964 | |||||||
965 | |||||||
966 | |||||||
967 | |||||||
968 | |||||||
969 | |||||||
970 | |||||||
973 | |||||||
974 | |||||||
977 | |||||||
980 | |||||||
983 | |||||||
985 | |||||||
986 | |||||||
988 | |||||||
989 | |||||||
990 | |||||||
991 | |||||||
992 | |||||||
997 | |||||||
998 | |||||||
1004 | |||||||
1005 | |||||||
1006 | |||||||
1007 | |||||||
1008 | |||||||
1009 | |||||||
1010 | |||||||
1011 | |||||||
1012 | |||||||
1013 | |||||||
1014 | |||||||
1015 | |||||||
1016 | |||||||
1017 | |||||||
1018 | |||||||
1019 | |||||||
1020 | |||||||
1021 | |||||||
1022 | |||||||
1023 | |||||||
1024 | |||||||
1025 | |||||||
1026 | |||||||
1027 | |||||||
1028 | |||||||
1029 | |||||||
1030 | |||||||
1031 | |||||||
1032 | |||||||
1033 | |||||||
1034 | |||||||
1035 | |||||||
1036 | |||||||
1037 | |||||||
1038 | |||||||
1039 | |||||||
1040 | |||||||
1041 | |||||||
1042 | |||||||
1043 | |||||||
1044 | |||||||
1045 | |||||||
1046 | |||||||
1047 | |||||||
1048 | |||||||
1049 | |||||||
1050 | |||||||
1051 | |||||||
1064 | |||||||
1219 | |||||||
1222 | |||||||
1224 | |||||||
1225 | |||||||
1226 | |||||||
1230 | |||||||
1288 | |||||||
1289 | |||||||
1290 | |||||||
1291 | |||||||
1293 | |||||||
1370 | |||||||
1371 | |||||||
1374 | |||||||
1376 | |||||||
1386 | |||||||
1445 | |||||||
1446 | |||||||
1448 | |||||||
1450 | |||||||
1453 | |||||||
1454 | |||||||
1456 | |||||||
1461 | |||||||
1465 | |||||||
1479 | |||||||
1480 | |||||||
1481 | |||||||
1678 | |||||||
1679 | |||||||
1680 | |||||||
1682 | |||||||
1683 | |||||||
1684 | |||||||
1685 | |||||||
1686 | |||||||
1687 | |||||||
1689 | |||||||
1690 | |||||||
1695 | |||||||
1698 | |||||||
1759 | |||||||
1761 | |||||||
1763 | |||||||
1782 | |||||||
1783 | |||||||
1787 | |||||||
1788 | |||||||
1825 | |||||||
1826 | |||||||
1828 | |||||||
1871 | |||||||
1891 | |||||||
1896 | |||||||
1897 | |||||||
1902 | |||||||
2001 | |||||||
2034 | |||||||
2040 | |||||||
2041 | |||||||
2091 | |||||||
2092 | |||||||
2093 | |||||||
2094 | |||||||
2095 | |||||||
2096 | |||||||
2097 | |||||||
2131 | |||||||
2139 | |||||||
2141 | |||||||
2142 | |||||||
2143 | |||||||
2144 | |||||||
2145 | |||||||
2146 | |||||||
2147 | |||||||
2148 | |||||||
2149 | |||||||
2150 | |||||||
2218 | |||||||
2220 | |||||||
2278 | |||||||
2279 | |||||||
2280 | |||||||
2285 | |||||||
2330 | |||||||
2332 | |||||||
2333 | |||||||
2410 | |||||||
2426 | |||||||
2427 | |||||||
2444 | |||||||
2447 | |||||||
2456 | |||||||
2457 | |||||||
2466 | |||||||
2477 | |||||||
2710 | |||||||
2767 | |||||||
2768 | |||||||
2769 | |||||||
2784 | |||||||
3000 | |||||||
3001 | |||||||
3002 | |||||||
3003 | |||||||
3008 | |||||||
3010 | |||||||
3020 | |||||||
3021 | |||||||
3022 | |||||||
3030 | |||||||
3035 | |||||||
3036 | |||||||
3037 | |||||||
3038 | |||||||
3039 | |||||||
3040 | |||||||
3042 | |||||||
3043 | |||||||
3044 | |||||||
3046 | |||||||
3105 | |||||||
3106 | |||||||
3107 | |||||||
3115 | |||||||
3116 | |||||||
3117 | |||||||
3118 | |||||||
3119 | |||||||
3143 | |||||||
3144 | |||||||
3193 | |||||||
3194 | |||||||
3227 | |||||||
3230 | |||||||
3234 | |||||||
3254 | |||||||
3307 | |||||||
3308 | |||||||
3309 | |||||||
3310 | |||||||
3311 | |||||||
3375 | |||||||
3380 | |||||||
3434 | |||||||
3435 | |||||||
3436 | |||||||
5458 | |||||||
5459 | |||||||
5471 | |||||||
In_pos_neg_data (72) | |||||||
Description (2) | |||||||
Reference (45) | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |