WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e61 | ||||||
Other_name | e61sd | |||||||
F27C1.8.1:c.607G>T | ||||||||
CE09720:p.Gly203Ter | ||||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | ||||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | ||||||
Mapping_target | F27C1 | |||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (325) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001067 | ||||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F27C1.8.1:c.607G>T | |||||||
HGVSp | CE09720:p.Gly203Ter | |||||||
cDNA_position | 607 | |||||||
CDS_position | 607 | |||||||
Protein_position | 203 | |||||||
Exon_number | 1/1 | |||||||
Codon_change | Gga/Tga | |||||||
Amino_acid_change | G/* | |||||||
Interactor | WBInteraction000052055 | |||||||
WBInteraction000052058 | ||||||||
WBInteraction000501358 | ||||||||
WBInteraction000501364 | ||||||||
WBInteraction000519055 | ||||||||
WBInteraction000537293 | ||||||||
WBInteraction000537294 | ||||||||
Genetics | Interpolated_map_position | I | -0.0011509 | |||||
Mapping_data | In_2_point (165) | |||||||
In_multi_point | 2 | |||||||
3 | ||||||||
4 | ||||||||
5 | ||||||||
6 | ||||||||
9 | ||||||||
10 | ||||||||
11 | ||||||||
12 | ||||||||
13 | ||||||||
14 | ||||||||
15 | ||||||||
17 | ||||||||
20 | ||||||||
21 | ||||||||
22 | ||||||||
23 | ||||||||
24 | ||||||||
27 | ||||||||
30 | ||||||||
31 | ||||||||
32 | ||||||||
33 | ||||||||
34 | ||||||||
35 | ||||||||
36 | ||||||||
37 | ||||||||
42 | ||||||||
43 | ||||||||
44 | ||||||||
197 | ||||||||
198 | ||||||||
199 | ||||||||
200 | ||||||||
201 | ||||||||
202 | ||||||||
204 | ||||||||
205 | ||||||||
231 | ||||||||
232 | ||||||||
233 | ||||||||
234 | ||||||||
235 | ||||||||
236 | ||||||||
238 | ||||||||
239 | ||||||||
240 | ||||||||
241 | ||||||||
243 | ||||||||
244 | ||||||||
245 | ||||||||
248 | ||||||||
250 | ||||||||
270 | ||||||||
271 | ||||||||
272 | ||||||||
289 | ||||||||
306 | ||||||||
308 | ||||||||
309 | ||||||||
310 | ||||||||
311 | ||||||||
312 | ||||||||
327 | ||||||||
328 | ||||||||
335 | ||||||||
336 | ||||||||
343 | ||||||||
344 | ||||||||
350 | ||||||||
360 | ||||||||
361 | ||||||||
364 | ||||||||
365 | ||||||||
372 | ||||||||
373 | ||||||||
380 | ||||||||
381 | ||||||||
391 | ||||||||
396 | ||||||||
397 | ||||||||
398 | ||||||||
399 | ||||||||
400 | ||||||||
401 | ||||||||
402 | ||||||||
403 | ||||||||
414 | ||||||||
420 | ||||||||
452 | ||||||||
454 | ||||||||
499 | ||||||||
505 | ||||||||
510 | ||||||||
511 | ||||||||
512 | ||||||||
515 | ||||||||
517 | ||||||||
518 | ||||||||
527 | ||||||||
538 | ||||||||
566 | ||||||||
567 | ||||||||
572 | ||||||||
573 | ||||||||
574 | ||||||||
575 | ||||||||
576 | ||||||||
604 | ||||||||
634 | ||||||||
635 | ||||||||
636 | ||||||||
637 | ||||||||
638 | ||||||||
639 | ||||||||
640 | ||||||||
693 | ||||||||
694 | ||||||||
696 | ||||||||
697 | ||||||||
719 | ||||||||
720 | ||||||||
734 | ||||||||
813 | ||||||||
815 | ||||||||
958 | ||||||||
959 | ||||||||
963 | ||||||||
964 | ||||||||
965 | ||||||||
966 | ||||||||
967 | ||||||||
968 | ||||||||
969 | ||||||||
970 | ||||||||
973 | ||||||||
974 | ||||||||
977 | ||||||||
980 | ||||||||
983 | ||||||||
985 | ||||||||
986 | ||||||||
988 | ||||||||
989 | ||||||||
990 | ||||||||
991 | ||||||||
992 | ||||||||
997 | ||||||||
998 | ||||||||
1004 | ||||||||
1005 | ||||||||
1006 | ||||||||
1007 | ||||||||
1008 | ||||||||
1009 | ||||||||
1010 | ||||||||
1011 | ||||||||
1012 | ||||||||
1013 | ||||||||
1014 | ||||||||
1015 | ||||||||
1016 | ||||||||
1017 | ||||||||
1018 | ||||||||
1019 | ||||||||
1020 | ||||||||
1021 | ||||||||
1022 | ||||||||
1023 | ||||||||
1024 | ||||||||
1025 | ||||||||
1026 | ||||||||
1027 | ||||||||
1028 | ||||||||
1029 | ||||||||
1030 | ||||||||
1031 | ||||||||
1032 | ||||||||
1033 | ||||||||
1034 | ||||||||
1035 | ||||||||
1036 | ||||||||
1037 | ||||||||
1038 | ||||||||
1039 | ||||||||
1040 | ||||||||
1041 | ||||||||
1042 | ||||||||
1043 | ||||||||
1044 | ||||||||
1045 | ||||||||
1046 | ||||||||
1047 | ||||||||
1048 | ||||||||
1049 | ||||||||
1050 | ||||||||
1051 | ||||||||
1064 | ||||||||
1219 | ||||||||
1222 | ||||||||
1224 | ||||||||
1225 | ||||||||
1226 | ||||||||
1230 | ||||||||
1288 | ||||||||
1289 | ||||||||
1290 | ||||||||
1291 | ||||||||
1293 | ||||||||
1370 | ||||||||
1371 | ||||||||
1374 | ||||||||
1376 | ||||||||
1386 | ||||||||
1445 | ||||||||
1446 | ||||||||
1448 | ||||||||
1450 | ||||||||
1453 | ||||||||
1454 | ||||||||
1456 | ||||||||
1461 | ||||||||
1465 | ||||||||
1479 | ||||||||
1480 | ||||||||
1481 | ||||||||
1678 | ||||||||
1679 | ||||||||
1680 | ||||||||
1682 | ||||||||
1683 | ||||||||
1684 | ||||||||
1685 | ||||||||
1686 | ||||||||
1687 | ||||||||
1689 | ||||||||
1690 | ||||||||
1695 | ||||||||
1698 | ||||||||
1759 | ||||||||
1761 | ||||||||
1763 | ||||||||
1782 | ||||||||
1783 | ||||||||
1787 | ||||||||
1788 | ||||||||
1825 | ||||||||
1826 | ||||||||
1828 | ||||||||
1871 | ||||||||
1891 | ||||||||
1896 | ||||||||
1897 | ||||||||
1902 | ||||||||
2001 | ||||||||
2034 | ||||||||
2040 | ||||||||
2041 | ||||||||
2091 | ||||||||
2092 | ||||||||
2093 | ||||||||
2094 | ||||||||
2095 | ||||||||
2096 | ||||||||
2097 | ||||||||
2131 | ||||||||
2139 | ||||||||
2141 | ||||||||
2142 | ||||||||
2143 | ||||||||
2144 | ||||||||
2145 | ||||||||
2146 | ||||||||
2147 | ||||||||
2148 | ||||||||
2149 | ||||||||
2150 | ||||||||
2218 | ||||||||
2220 | ||||||||
2278 | ||||||||
2279 | ||||||||
2280 | ||||||||
2285 | ||||||||
2330 | ||||||||
2332 | ||||||||
2333 | ||||||||
2410 | ||||||||
2426 | ||||||||
2427 | ||||||||
2444 | ||||||||
2447 | ||||||||
2456 | ||||||||
2457 | ||||||||
2466 | ||||||||
2477 | ||||||||
2710 | ||||||||
2767 | ||||||||
2768 | ||||||||
2769 | ||||||||
2784 | ||||||||
3000 | ||||||||
3001 | ||||||||
3002 | ||||||||
3003 | ||||||||
3008 | ||||||||
3010 | ||||||||
3020 | ||||||||
3021 | ||||||||
3022 | ||||||||
3030 | ||||||||
3035 | ||||||||
3036 | ||||||||
3037 | ||||||||
3038 | ||||||||
3039 | ||||||||
3040 | ||||||||
3042 | ||||||||
3043 | ||||||||
3044 | ||||||||
3046 | ||||||||
3105 | ||||||||
3106 | ||||||||
3107 | ||||||||
3115 | ||||||||
3116 | ||||||||
3117 | ||||||||
3118 | ||||||||
3119 | ||||||||
3143 | ||||||||
3144 | ||||||||
3193 | ||||||||
3194 | ||||||||
3227 | ||||||||
3230 | ||||||||
3234 | ||||||||
3254 | ||||||||
3307 | ||||||||
3308 | ||||||||
3309 | ||||||||
3310 | ||||||||
3311 | ||||||||
3375 | ||||||||
3380 | ||||||||
3434 | ||||||||
3435 | ||||||||
3436 | ||||||||
5458 | ||||||||
5459 | ||||||||
5471 | ||||||||
In_pos_neg_data (72) | ||||||||
Description | Phenotype | WBPhenotype:0000072 | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | |||||||
Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | ||||
Curator_confirmed | WBPerson3900 | |||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "This ability of a mutation in one collagen to affect others was further confirmed for the non-stage-specific collagen DPY-7, after costaining of the TP14:dpy-5(e61)I;kaIs12(col-19::gfp) strain with the DPY-7 monoclonal antibodies (Fig. 3C, red). In the dorsal/ventral hypodermal cells, DPY-7 localized in a regular but constricted pattern that corresponded to the annular furrows (Fig. 3C, denoted an) and was similar to the COL-19::GFP patterns observed in wild-type and in dpy-5 mutants. Conversely, in the matrix overlying the lateral seam cell cords, DPY-7 expression was abnormal: the DPY-7 staining pattern appeared broken (Fig. 3C, denoted by double-headed arrow) and generally deviated from the wildtype staining pattern in which both annuli (COL-19) and annular furrows (DPY-7) normally extend to appose the lateral ala (Fig. 1C)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | ||||||
WBPaper00005747 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed (3) | ||||||||
Remark | strong dumpy; early larvae non-dumpy; e61/+ is very slightly dumpy | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Authors report "strong dpy" (Table 1); "It is interesting to note that the annuli overlying the ventral and dorsal hypodermis are present but differ markedly from wild-type nematodes (Fig. 1E, double-headed arrows) in that they do not oppose the lateral alae (Fig. 3A,E, double-headed arrows). As a result, the cuticle above the lateral hypodermal seam cell cords, having failed to contract normally, is extended, and this results in the characteristic Dpy phenotype." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Semi_dominant | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "In some areas corresponding to the seam cell cords, large vesicles are evident and the tagged protein is found concentrated at the periphery of these structures (Fig. 3D), perhaps indicating a failure in the complete secretion of COL-19::GFP." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "When the strain TP14:dpy-5(e61) I;kaIs12(col-19::gfp), resulting from crossing TP12:kaIs(col-19::gfp) with the dpy-5(e61) mutant, was examined under epifluorescence, the ala, apparent by means of Nomarski imaging (Fig. 3E), were shown to express COL-19::GFP in a variable manner (Fig. 3B, arrowed). In addition, two distinct regions became apparent: a region overlying the dorsal/ventral hypodermal cells, which showed annuli fluorescing as distinct bands as observed in wildtype TP12:kaIs(col-19::gfp) worms (Fig. 3B-D, denoted an), and a second, extended region of disruption overlying the seam cell cords (Fig. 3B-D, double-headed arrows)... The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)... These data show that mutation of the DPY-5 collagen in these nematodes is sufficient to alter the expression patterns of the COL-19::GFP collagen." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1); "The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1); "The disrupted region did not have the characteristic annuli and instead appeared featureless when viewed by Nomarski microscopy (Fig. 3E, double-headed arrow). The regular annular fluorescence did appear more closely packed than in wildtype nematodes (Fig. 3B-D, denoted an), having a periodicity of approximately 0.75 μm compared with 1.2 μm, respectively, an observation consistent with the shorter length of these adult nematodes." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00053771 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Hypersensitive to the reactive small molecule and prooxidant juglone. | Paper_evidence | WBPaper00053771 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (45) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |