WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
| WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e61 | |||||||
| Other_name | e61sd | ||||||||
| F27C1.8.1:c.607G>T | |||||||||
| CE09720:p.Gly203Ter | |||||||||
| HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F27C1 | |||||
| Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||||
| Mapping_target | F27C1 | ||||||||
| Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin (4) | |||||||||
| Affects | Gene | WBGene00001067 | |||||||
| Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F27C1.8.1:c.607G>T | ||||||||
| HGVSp | CE09720:p.Gly203Ter | ||||||||
| cDNA_position | 607 | ||||||||
| CDS_position | 607 | ||||||||
| Protein_position | 203 | ||||||||
| Exon_number | 1/1 | ||||||||
| Codon_change | Gga/Tga | ||||||||
| Amino_acid_change | G/* | ||||||||
| Interactor | WBInteraction000052055 | ||||||||
| WBInteraction000052058 | |||||||||
| WBInteraction000501358 | |||||||||
| WBInteraction000501364 | |||||||||
| WBInteraction000519055 | |||||||||
| WBInteraction000537293 | |||||||||
| WBInteraction000537294 | |||||||||
| Genetics | Interpolated_map_position | I | -0.0011509 | ||||||
| Mapping_data | In_2_point | 1 | |||||||
| 3 | |||||||||
| 4 | |||||||||
| 6 | |||||||||
| 7 | |||||||||
| 8 | |||||||||
| 9 | |||||||||
| 10 | |||||||||
| 11 | |||||||||
| 12 | |||||||||
| 13 | |||||||||
| 14 | |||||||||
| 15 | |||||||||
| 16 | |||||||||
| 17 | |||||||||
| 18 | |||||||||
| 19 | |||||||||
| 20 | |||||||||
| 22 | |||||||||
| 23 | |||||||||
| 24 | |||||||||
| 25 | |||||||||
| 26 | |||||||||
| 27 | |||||||||
| 29 | |||||||||
| 31 | |||||||||
| 205 | |||||||||
| 211 | |||||||||
| 238 | |||||||||
| 239 | |||||||||
| 240 | |||||||||
| 241 | |||||||||
| 243 | |||||||||
| 246 | |||||||||
| 247 | |||||||||
| 259 | |||||||||
| 265 | |||||||||
| 330 | |||||||||
| 391 | |||||||||
| 392 | |||||||||
| 393 | |||||||||
| 394 | |||||||||
| 410 | |||||||||
| 424 | |||||||||
| 441 | |||||||||
| 442 | |||||||||
| 446 | |||||||||
| 464 | |||||||||
| 472 | |||||||||
| 478 | |||||||||
| 490 | |||||||||
| 524 | |||||||||
| 561 | |||||||||
| 565 | |||||||||
| 566 | |||||||||
| 570 | |||||||||
| 572 | |||||||||
| 574 | |||||||||
| 599 | |||||||||
| 602 | |||||||||
| 614 | |||||||||
| 618 | |||||||||
| 642 | |||||||||
| 643 | |||||||||
| 646 | |||||||||
| 738 | |||||||||
| 787 | |||||||||
| 788 | |||||||||
| 1019 | |||||||||
| 2492 | |||||||||
| 2493 | |||||||||
| 2494 | |||||||||
| 2495 | |||||||||
| 2497 | |||||||||
| 2498 | |||||||||
| 2499 | |||||||||
| 2500 | |||||||||
| 2501 | |||||||||
| 2502 | |||||||||
| 2505 | |||||||||
| 2506 | |||||||||
| 2520 | |||||||||
| 2521 | |||||||||
| 2522 | |||||||||
| 2523 | |||||||||
| 2524 | |||||||||
| 2525 | |||||||||
| 2526 | |||||||||
| 2527 | |||||||||
| 2528 | |||||||||
| 2529 | |||||||||
| 2530 | |||||||||
| 2531 | |||||||||
| 2532 | |||||||||
| 2533 | |||||||||
| 2534 | |||||||||
| 2535 | |||||||||
| 2536 | |||||||||
| 2537 | |||||||||
| 2538 | |||||||||
| 2539 | |||||||||
| 2540 | |||||||||
| 2541 | |||||||||
| 2542 | |||||||||
| 2543 | |||||||||
| 2544 | |||||||||
| 2545 | |||||||||
| 2546 | |||||||||
| 2547 | |||||||||
| 2548 | |||||||||
| 2549 | |||||||||
| 2550 | |||||||||
| 2551 | |||||||||
| 2552 | |||||||||
| 2553 | |||||||||
| 2554 | |||||||||
| 2555 | |||||||||
| 2556 | |||||||||
| 2590 | |||||||||
| 2591 | |||||||||
| 3194 | |||||||||
| 3195 | |||||||||
| 3197 | |||||||||
| 3198 | |||||||||
| 3199 | |||||||||
| 3203 | |||||||||
| 3206 | |||||||||
| 3209 | |||||||||
| 3684 | |||||||||
| 3685 | |||||||||
| 3686 | |||||||||
| 4228 | |||||||||
| 4747 | |||||||||
| 5225 | |||||||||
| 5230 | |||||||||
| 5246 | |||||||||
| 5252 | |||||||||
| 5518 | |||||||||
| 5837 | |||||||||
| 6024 | |||||||||
| 6029 | |||||||||
| 6030 | |||||||||
| 6031 | |||||||||
| 6032 | |||||||||
| 6033 | |||||||||
| 6041 | |||||||||
| 6042 | |||||||||
| 6043 | |||||||||
| 6049 | |||||||||
| 6050 | |||||||||
| 6051 | |||||||||
| 6064 | |||||||||
| 6068 | |||||||||
| 6070 | |||||||||
| 6078 | |||||||||
| 6079 | |||||||||
| 6081 | |||||||||
| 6082 | |||||||||
| 6084 | |||||||||
| 6085 | |||||||||
| 6086 | |||||||||
| 6087 | |||||||||
| 6171 | |||||||||
| 6194 | |||||||||
| 6221 | |||||||||
| In_multi_point (349) | |||||||||
| In_pos_neg_data (72) | |||||||||
| Description | Phenotype (10) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference (45) | |||||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
| Method | Substitution_allele |
