WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e61 | |||||||
Other_name | e61sd | ||||||||
F27C1.8.1:c.607G>T | |||||||||
CE09720:p.Gly203Ter | |||||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||||
Mapping_target | F27C1 | ||||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001067 | |||||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F27C1.8.1:c.607G>T | ||||||||
HGVSp | CE09720:p.Gly203Ter | ||||||||
cDNA_position | 607 | ||||||||
CDS_position | 607 | ||||||||
Protein_position | 203 | ||||||||
Exon_number | 1/1 | ||||||||
Codon_change | Gga/Tga | ||||||||
Amino_acid_change | G/* | ||||||||
Interactor | WBInteraction000052055 | ||||||||
WBInteraction000052058 | |||||||||
WBInteraction000501358 | |||||||||
WBInteraction000501364 | |||||||||
WBInteraction000519055 | |||||||||
WBInteraction000537293 | |||||||||
WBInteraction000537294 | |||||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||||
Mapping_data | In_2_point | 1 | |||||||
3 | |||||||||
4 | |||||||||
6 | |||||||||
7 | |||||||||
8 | |||||||||
9 | |||||||||
10 | |||||||||
11 | |||||||||
12 | |||||||||
13 | |||||||||
14 | |||||||||
15 | |||||||||
16 | |||||||||
17 | |||||||||
18 | |||||||||
19 | |||||||||
20 | |||||||||
22 | |||||||||
23 | |||||||||
24 | |||||||||
25 | |||||||||
26 | |||||||||
27 | |||||||||
29 | |||||||||
31 | |||||||||
205 | |||||||||
211 | |||||||||
238 | |||||||||
239 | |||||||||
240 | |||||||||
241 | |||||||||
243 | |||||||||
246 | |||||||||
247 | |||||||||
259 | |||||||||
265 | |||||||||
330 | |||||||||
391 | |||||||||
392 | |||||||||
393 | |||||||||
394 | |||||||||
410 | |||||||||
424 | |||||||||
441 | |||||||||
442 | |||||||||
446 | |||||||||
464 | |||||||||
472 | |||||||||
478 | |||||||||
490 | |||||||||
524 | |||||||||
561 | |||||||||
565 | |||||||||
566 | |||||||||
570 | |||||||||
572 | |||||||||
574 | |||||||||
599 | |||||||||
602 | |||||||||
614 | |||||||||
618 | |||||||||
642 | |||||||||
643 | |||||||||
646 | |||||||||
738 | |||||||||
787 | |||||||||
788 | |||||||||
1019 | |||||||||
2492 | |||||||||
2493 | |||||||||
2494 | |||||||||
2495 | |||||||||
2497 | |||||||||
2498 | |||||||||
2499 | |||||||||
2500 | |||||||||
2501 | |||||||||
2502 | |||||||||
2505 | |||||||||
2506 | |||||||||
2520 | |||||||||
2521 | |||||||||
2522 | |||||||||
2523 | |||||||||
2524 | |||||||||
2525 | |||||||||
2526 | |||||||||
2527 | |||||||||
2528 | |||||||||
2529 | |||||||||
2530 | |||||||||
2531 | |||||||||
2532 | |||||||||
2533 | |||||||||
2534 | |||||||||
2535 | |||||||||
2536 | |||||||||
2537 | |||||||||
2538 | |||||||||
2539 | |||||||||
2540 | |||||||||
2541 | |||||||||
2542 | |||||||||
2543 | |||||||||
2544 | |||||||||
2545 | |||||||||
2546 | |||||||||
2547 | |||||||||
2548 | |||||||||
2549 | |||||||||
2550 | |||||||||
2551 | |||||||||
2552 | |||||||||
2553 | |||||||||
2554 | |||||||||
2555 | |||||||||
2556 | |||||||||
2590 | |||||||||
2591 | |||||||||
3194 | |||||||||
3195 | |||||||||
3197 | |||||||||
3198 | |||||||||
3199 | |||||||||
3203 | |||||||||
3206 | |||||||||
3209 | |||||||||
3684 | |||||||||
3685 | |||||||||
3686 | |||||||||
4228 | |||||||||
4747 | |||||||||
5225 | |||||||||
5230 | |||||||||
5246 | |||||||||
5252 | |||||||||
5518 | |||||||||
5837 | |||||||||
6024 | |||||||||
6029 | |||||||||
6030 | |||||||||
6031 | |||||||||
6032 | |||||||||
6033 | |||||||||
6041 | |||||||||
6042 | |||||||||
6043 | |||||||||
6049 | |||||||||
6050 | |||||||||
6051 | |||||||||
6064 | |||||||||
6068 | |||||||||
6070 | |||||||||
6078 | |||||||||
6079 | |||||||||
6081 | |||||||||
6082 | |||||||||
6084 | |||||||||
6085 | |||||||||
6086 | |||||||||
6087 | |||||||||
6171 | |||||||||
6194 | |||||||||
6221 | |||||||||
In_multi_point (349) | |||||||||
In_pos_neg_data (72) | |||||||||
Description | Phenotype (10) | ||||||||
Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (45) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |