WormBase Tree Display for Sequence: Y38E10A

Y38E10A DNA: Y38E10A 110937
  SMap: S_child (11)
  Structure: From: Source: CHROMOSOME_II
    Overlap_right: Y46G5A 110838
    Overlap_left: F49C5
    Clone_left_end: Y46G5 110838
      Y38E10A 1
    Clone_right_end: F49C5 100
      Y38E10A 110937
  DB_info: Database: EMBL NDB_AC AL110484
        NDB_SV AL110484.3
    Secondary_accession: AL021149
    DB_remark: [030423 dl] Sequence correction based on Thierry-Mieg WTP analysis
      [121025] Sequence correction: SNP 0 bases @ 25763
      [121025] Sequence correction: SNP 0 bases @ 89139
      [121025] Sequence correction: SNP 0 bases @ 89718
      [121025] Sequence correction: SNP 0 bases @ 101148
      [121025] Sequence correction: SNP 0 bases @ 107622
      [121025] Sequence correction WBsf267905 : Insertion A1 bases from @ 37827
      [121025] Sequence correction WBsf268176 : Insertion G1 bases from @ 98978
      [121025] Sequence correction WBsf268207 : Insertion A1 bases from @ 105909
      [121025] Sequence correction WBsf268316 : Insertion G1 bases from @ 107513
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: Wallis JM
    From_laboratory: HX
    Date_directory: 011009
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: Y38E10A
  Properties: Genomic_canonical
    Checksum: MD5: 7cded92680b7e00134fce28e4b71464d
    Status: Finished: 20 May 1999 00:00:00
      Submitted: 20 May 1999 00:00:00
      Annotated: 26 Oct 1999 00:00:00
  Map: Sequence-II Ends: Left: 7396
        Right: 7427
  Interpolated_map_position: II 10.5264
  Assembly_tags: Finished Left 4 1 Y38E10A
    Clone right end 100 97 F49C5
    annotation 13071 13041 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Uni-directional primer reads, in inverted repeat.
      7096 7559 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Each element 38 base pairs long, typical sequence: TGCCAAAGTTGCCGAACCCAAAAATTTTCGGCAACCGG A restriction digest has not been used to confirm the size of the repeat region in this assembly.
      89662 89700 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from terminator reads from a single clone.
      90830 90823 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from a terminator read and a primer read from one clone.
      61632 61688 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here -
      79189 79637 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Each element 37 base pairs long, typical sequence: AATTTTTTGAAAATATTTTGGCTGGAATTTAAAATTT The region is spanned by a pUC clone whose insert size confirms the size of the repeat region in this assembly.
      79624 80081 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from reads from a short insert library derived from a single pUC clone.
      79661 81759 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Unknown length. Each repeat element 15 bases long, typical sequence: GAGACCAATCGTGGT
      105549 105623 First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from terminator reads from a single clone.
    comment 84467 84548 seq checked by jes
      89655 89764 checked by jes
    Clone left end 110843 110838 Y46G5
    Finished Right 110937 110934 Y38E10A
  Method: Genomic_canonical