Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Sequence: Y38E10A

expand all nodes | collapse all nodes | view schema

Name Class

Y38E10ADNAY38E10A110937
SMapS_child (11)
StructureFromSourceCHROMOSOME_II
Overlap_rightY46G5A110838
Overlap_leftF49C5
Clone_left_endY46G5110838
Y38E10A1
Clone_right_endF49C5100
Y38E10A110937
DB_infoDatabaseEMBLNDB_ACAL110484
NDB_SVAL110484.3
Secondary_accessionAL021149
DB_remark[030423 dl] Sequence correction based on Thierry-Mieg WTP analysis
[121025] Sequence correction: SNP 0 bases @ 25763
[121025] Sequence correction: SNP 0 bases @ 89139
[121025] Sequence correction: SNP 0 bases @ 89718
[121025] Sequence correction: SNP 0 bases @ 101148
[121025] Sequence correction: SNP 0 bases @ 107622
[121025] Sequence correction WBsf267905 : Insertion A1 bases from @ 37827
[121025] Sequence correction WBsf268176 : Insertion G1 bases from @ 98978
[121025] Sequence correction WBsf268207 : Insertion A1 bases from @ 105909
[121025] Sequence correction WBsf268316 : Insertion G1 bases from @ 107513
KeywordHTG
EMBL_dump_infoEMBL_dump_methodworm_EMBL-dump
OriginFrom_authorWallis JM
From_laboratoryHX
Date_directory011009
SpeciesCaenorhabditis elegans
StrainWBStrain00000001
VisibleCloneY38E10A
PropertiesGenomic_canonical
ChecksumMD57cded92680b7e00134fce28e4b71464d
Status (3)
MapSequence-IIEndsLeft7396
Right7427
Interpolated_map_positionII10.5264
Assembly_tagsFinished Left41Y38E10A
Clone right end10097F49C5
annotation1307113041First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Uni-directional primer reads, in inverted repeat.
70967559First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Each element 38 base pairs long, typical sequence: TGCCAAAGTTGCCGAACCCAAAAATTTTCGGCAACCGG A restriction digest has not been used to confirm the size of the repeat region in this assembly.
8966289700First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from terminator reads from a single clone.
9083090823First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from a terminator read and a primer read from one clone.
6163261688First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here -
7918979637First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Each element 37 base pairs long, typical sequence: AATTTTTTGAAAATATTTTGGCTGGAATTTAAAATTT The region is spanned by a pUC clone whose insert size confirms the size of the repeat region in this assembly.
7962480081First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from reads from a short insert library derived from a single pUC clone.
7966181759First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Unknown length. Each repeat element 15 bases long, typical sequence: GAGACCAATCGTGGT
105549105623First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from terminator reads from a single clone.
comment8446784548seq checked by jes
8965589764checked by jes
Clone left end110843110838Y46G5
Finished Right110937110934Y38E10A
MethodGenomic_canonical