WormBase Tree Display for Sequence: Y38E10A
expand all nodes | collapse all nodes | view schema
Y38E10A | DNA | Y38E10A | 110937 | ||
---|---|---|---|---|---|
SMap | S_child (11) | ||||
Structure | From | Source | CHROMOSOME_II | ||
Overlap_right | Y46G5A | 110838 | |||
Overlap_left | F49C5 | ||||
Clone_left_end | Y46G5 | 110838 | |||
Y38E10A | 1 | ||||
Clone_right_end | F49C5 | 100 | |||
Y38E10A | 110937 | ||||
DB_info | Database | EMBL | NDB_AC | AL110484 | |
NDB_SV | AL110484.3 | ||||
Secondary_accession | AL021149 | ||||
DB_remark (10) | |||||
Keyword | HTG | ||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
Origin | From_author | Wallis JM | |||
From_laboratory | HX | ||||
Date_directory | 011009 | ||||
Species | Caenorhabditis elegans | ||||
Strain | WBStrain00000001 | ||||
Visible | Clone | Y38E10A | |||
Properties | Genomic_canonical | ||||
Checksum | MD5 | 7cded92680b7e00134fce28e4b71464d | |||
Status | Finished | 20 May 1999 00:00:00 | |||
Submitted | 20 May 1999 00:00:00 | ||||
Annotated | 26 Oct 1999 00:00:00 | ||||
Map | Sequence-II | Ends | Left | 7396 | |
Right | 7427 | ||||
Interpolated_map_position | II | 10.5264 | |||
Assembly_tags | Finished Left | 4 | 1 | Y38E10A | |
Clone right end | 100 | 97 | F49C5 | ||
annotation | 13071 | 13041 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Uni-directional primer reads, in inverted repeat. | ||
7096 | 7559 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Each element 38 base pairs long, typical sequence: TGCCAAAGTTGCCGAACCCAAAAATTTTCGGCAACCGG A restriction digest has not been used to confirm the size of the repeat region in this assembly. | |||
89662 | 89700 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from terminator reads from a single clone. | |||
90830 | 90823 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from a terminator read and a primer read from one clone. | |||
61632 | 61688 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - | |||
79189 | 79637 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Each element 37 base pairs long, typical sequence: AATTTTTTGAAAATATTTTGGCTGGAATTTAAAATTT The region is spanned by a pUC clone whose insert size confirms the size of the repeat region in this assembly. | |||
79624 | 80081 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from reads from a short insert library derived from a single pUC clone. | |||
79661 | 81759 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Unknown length. Each repeat element 15 bases long, typical sequence: GAGACCAATCGTGGT | |||
105549 | 105623 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Sequence from terminator reads from a single clone. | |||
comment | 84467 | 84548 | seq checked by jes | ||
89655 | 89764 | checked by jes | |||
Clone left end | 110843 | 110838 | Y46G5 | ||
Finished Right | 110937 | 110934 | Y38E10A | ||
Method | Genomic_canonical |