WormBase Tree Display for Feature: WBsf919529
expand all nodes | collapse all nodes | view schema
| WBsf919529 | SMap | S_parent | Sequence | R13A5 |
|---|---|---|---|---|
| Name | Public_name | POP-1 binding site | ||
| Sequence_details | Flanking_sequences | tttgttagaacaaaatttagatttattttt | cacattaccaatttttttaaaaacttctta | |
| Mapping_target | R13A5 | |||
| DNA_text | CTTTTGATG | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is a POP-1 binding site. | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00005094 | ||
| Associations | Associated_with_gene | WBGene00000437 | ||
| Associated_with_Interaction | WBInteraction000521664 | |||
| Associated_with_transcription_factor | WBTranscriptionFactor000102 | |||
| Bound_by_product_of | WBGene00004077 | |||
| Remark | Experimental evidence for binding site (CTTTTGATG) for pop-1 3443 to 3476 upstream of ceh-13 start codon. [2013-07-23 gw3] | |||
| Method | TF_binding_site |
