WormBase Tree Display for Feature: WBsf034318
expand all nodes | collapse all nodes | view schema
| WBsf034318 | SMap | S_parent | Sequence | C29E4 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tggcgctgctccgctatttaaaagactgaaagtgacataaatgatctaatttccagatctcttataactttttttatagcggt | ctatattttctttcttatcaatttttcagcttttcaacattttccagttagttattcaatttttattccgcacgatcactgctgt | |
| Mapping_target | C29E4 | |||
| DNA_text | tccactcctaatttgatgtgtttacttgttgcatcagatcatttttcacttcttgtaattcttatcagtttt | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Transcription factor binding site | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00031042 | ||
| Associations | Associated_with_gene | WBGene00016204 | ||
| Remark | The region curated lies within the ~300bp minimal promoter and contains information essential for proper transcription. Within this region is a motif fitting the consensus sequence T/A(GATA)A/G, the binding site for the GATA family transcription factors, shown to be necessary for expression of other intestinal cell-specific genes. | Paper_evidence | WBPaper00031042 | |
| Method | promoter |
