WormBase Tree Display for Feature: WBsf034318
expand all nodes | collapse all nodes | view schema
WBsf034318 | SMap | S_parent | Sequence | C29E4 |
---|---|---|---|---|
Sequence_details (2) | ||||
DNA_text | tccactcctaatttgatgtgtttacttgttgcatcagatcatttttcacttcttgtaattcttatcagtttt | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00031042 | ||
Associations | Associated_with_gene | WBGene00016204 | ||
Remark | The region curated lies within the ~300bp minimal promoter and contains information essential for proper transcription. Within this region is a motif fitting the consensus sequence T/A(GATA)A/G, the binding site for the GATA family transcription factors, shown to be necessary for expression of other intestinal cell-specific genes. | Paper_evidence | WBPaper00031042 | |
Method | promoter |