WormBase Tree Display for Feature: WBsf028064
expand all nodes | collapse all nodes | view schema
| WBsf028064 | SMap | S_parent | Sequence | T22B7 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tgtgtagagaatggtattgttgtgaatcga | tagattgctttttttggtcggccgtttcac | |
| Mapping_target | T22B7 | |||
| DNA_text | ttagtca | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | LAG-1 Fox/Jun heterodimer binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00031111 | ||
| Associations | Associated_with_gene | WBGene00001182 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000101 | |||
| Bound_by_product_of | WBGene00002245 | |||
| WBGene00012005 | ||||
| WBGene00001345 | ||||
| Remark | The 1.3kb Upstream Regulatory Sequence (URS) contains binding elements for LAG-1 and the Fos/Jun heterdimer | Paper_evidence | WBPaper00031111 | |
| Method | TF_binding_site |
