WormBase Tree Display for Feature: WBsf019182
expand all nodes | collapse all nodes | view schema
WBsf019182 | SMap | S_parent | Sequence | C12C8 | |
---|---|---|---|---|---|
Name | Public_name | LCS 6 | |||
Sequence_details (2) | |||||
DNA_text | aattaaaacacccacaatagcacctc | ||||
Origin | Species | Caenorhabditis elegans | |||
Visible | Description | This is the let-7 'LCS 6' binding site in the 3' UTR of lin-41. | |||
SO_term | SO:0000409 | ||||
Defined_by | Defined_by_paper | WBPaper00003929 | Person_evidence | WBPerson4025 | |
WBPaper00006376 | Person_evidence | WBPerson1983 | |||
Associations | Associated_with_gene | WBGene00003026 | |||
Bound_by_product_of | WBGene00002285 | ||||
Remark | This is the miRNA let-7 complementary sequence 6 (LCS 6). [2014-09-02 gw3] | ||||
Method | binding_site |