WormBase Tree Display for Feature: WBsf019179
expand all nodes | collapse all nodes | view schema
| WBsf019179 | SMap | S_parent | Sequence | C12C8 | |
|---|---|---|---|---|---|
| Name | Public_name | LCS 3 | |||
| Sequence_details | Flanking_sequences | aacacccacaatagcacctcttttcctcaa | ttatacaaccgttctacactcaacgcgatg | ||
| Mapping_target | C12C8 | ||||
| DNA_text | auugcaccaacucaaguauaccuu | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | This is the let-7 'LCS 3' binding site in the 3' UTR of lin-41. | |||
| SO_term | SO:0000409 | ||||
| Defined_by | Defined_by_paper | WBPaper00003929 | Person_evidence | WBPerson4025 | |
| WBPaper00006376 | Person_evidence | WBPerson1983 | |||
| Associations | Associated_with_gene | WBGene00003026 | |||
| Associated_with_Interaction | WBInteraction000524232 | ||||
| Bound_by_product_of | WBGene00002285 | ||||
| Remark | This is the miRNA let-7 complementary sequence 3 (LCS 3). [2014-09-02 gw3] | ||||
| Method | binding_site |
