WormBase Tree Display for Variation: WBVar02154143
expand all nodes | collapse all nodes | view schema
WBVar02154143 | Evidence | Curator_confirmed | WBPerson1983 | ||
---|---|---|---|---|---|
Name | Public_name | ve578 | |||
HGVSg | CHROMOSOME_X:g.12877412_12880115del | ||||
Sequence_details | SMap | S_parent | Sequence | K02A4 | |
Flanking_sequences | ttaacacccgtatcattatcatttccatgc | cccaacttccttccaccccctcaaaaagcg | |||
Mapping_target | K02A4 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Engineered_allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00047484 | ||||
Production_method | CRISPR_Cas9 | ||||
Status | Live | ||||
Affects | Gene | WBGene00199301 | |||
WBGene00001149 | |||||
Transcript | K02A4.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-1632 | ||||
Intron_number | 2-6/7 | ||||
Exon_number | 1-8/8 | ||||
K02A4.8 | VEP_consequence | transcript_ablation | |||
VEP_impact | HIGH | ||||
Exon_number | 1/1 | ||||
Remark | Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | ||||
Allele Description:+/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. | |||||
Method | Engineered_allele |