WormBase Tree Display for Variation: WBVar02153601
expand all nodes | collapse all nodes | view schema
WBVar02153601 | Name | Public_name | gk5062 | ||
---|---|---|---|---|---|
Other_name | T23G11.6a.1:c.744_1830+174del | ||||
T23G11.5b.1:c.152+603_152+2641del | |||||
T23G11.5a.1:c.776+603_776+2641del | |||||
T23G11.6b.1:c.744_1843+161del | |||||
HGVSg | CHROMOSOME_I:g.7685765_7687803del | ||||
Sequence_details | SMap | S_parent | Sequence | T23G11 | |
Flanking_sequences | TGCTGTCGTATTTTTGTTACAGTACCTACG | GGTGGTTGGAAGATTCCATCAGCACGTGAT | |||
Mapping_target | CHROMOSOME_I | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037917 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00011971 | |||
WBGene00011970 | |||||
Transcript | T23G11.5a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | T23G11.5a.1:c.776+603_776+2641del | ||||
Intron_number | 6/10 | ||||
T23G11.6a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | T23G11.6a.1:c.744_1830+174del | ||||
cDNA_position | 801-? | ||||
CDS_position | 744-? | ||||
Protein_position | 248-? | ||||
Intron_number | 7-12/13 | ||||
Exon_number | 7-12/14 | ||||
T23G11.6c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 2-3/4 | ||||
Exon_number | 1-3/5 | ||||
T23G11.6b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | T23G11.6b.1:c.744_1843+161del | ||||
cDNA_position | 744-? | ||||
CDS_position | 744-? | ||||
Protein_position | 248-? | ||||
Intron_number | 6-11/12 | ||||
Exon_number | 6-11/13 | ||||
T23G11.5b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T23G11.5b.1:c.152+603_152+2641del | ||||
Intron_number | 2/5 | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Genetics | Interpolated_map_position | I | 2.23852 | ||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced. | |||||
Method | Deletion_allele |