WormBase Tree Display for Strain: WBStrain00037917
expand all nodes | collapse all nodes | view schema
| WBStrain00037917 | Status | Live | ||
|---|---|---|---|---|
| Genotype | lron-9(gk5062[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. | |||
| Public_name | VC4100 | |||
| Contains | Gene | WBGene00001067 | ||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| WBGene00011971 | ||||
| Variation | WBVar02153601 | |||
| Rearrangement | tmC18 | |||
| Transgene | WBTransgene00024753 | |||
| Properties | Outcrossed | x1 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 15 Mar 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous lethal deletion balanced by tmC18. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes and Dpy non-GFP (tmC18). Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
| Species | Caenorhabditis elegans |
