WormBase Tree Display for Variation: WBVar02153599
expand all nodes | collapse all nodes | view schema
WBVar02153599 | Name | Public_name | gk5045 | ||
---|---|---|---|---|---|
Other_name | F26B1.2b.3:c.-26_*889del | ||||
F26B1.2b.2:c.-26_*880del | |||||
CE09674:p.Ile9ArgfsTer20 | |||||
F26B1.2a.1:c.26_1179del | |||||
F26B1.2d.2:c.-26_*1194del | |||||
HGVSg | CHROMOSOME_I:g.6317742_6319717del | ||||
Sequence_details | SMap | S_parent | Sequence | F26B1 | |
Flanking_sequences | TCAAAATGATGATCAAAGTGGGAGCCGCTA | GGTGGATCTGTCTAGGTTCTGGTGTTCGTA | |||
Mapping_target | CHROMOSOME_I | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037915 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00017816 | |||
Transcript | F26B1.2d.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,stop_retained_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | F26B1.2d.2:c.-26_*1194del | ||||
cDNA_position | 46-1481 | ||||
Intron_number | 1-7/7 | ||||
Exon_number | 1-8/8 | ||||
F26B1.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | ?-1087 | ||||
Intron_number | 2-7/7 | ||||
Exon_number | 1-8/8 | ||||
F26B1.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | ?-1131 | ||||
CDS_position | ?-1128 | ||||
Protein_position | ?-376 | ||||
Intron_number | 2-7/8 | ||||
Exon_number | 1-8/9 | ||||
F26B1.2d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | ?-1404 | ||||
Intron_number | 2-6/6 | ||||
Exon_number | 1-7/7 | ||||
F26B1.2b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,stop_retained_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F26B1.2b.2:c.-26_*880del | ||||
cDNA_position | 44-1153 | ||||
Intron_number | 1-8/8 | ||||
Exon_number | 1-9/9 | ||||
F26B1.2e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | 26-? | ||||
CDS_position | 26-? | ||||
Protein_position | 9-? | ||||
Intron_number | 1-3/3 | ||||
Exon_number | 1-4/4 | ||||
F26B1.2b.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,stop_retained_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F26B1.2b.3:c.-26_*889del | ||||
cDNA_position | 44-1162 | ||||
Intron_number | 1-8/8 | ||||
Exon_number | 1-9/9 | ||||
F26B1.2a.1 (11) | |||||
F26B1.2b.4 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | ?-1110 | ||||
Intron_number | 2-7/7 | ||||
Exon_number | 1-8/8 | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Genetics | Interpolated_map_position | I | 0.982616 | ||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced. | |||||
Method | Deletion_allele |