WormBase Tree Display for Strain: WBStrain00037915
expand all nodes | collapse all nodes | view schema
| WBStrain00037915 | Status | Live | ||
|---|---|---|---|---|
| Genotype | hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. | |||
| Public_name | VC4098 | |||
| Contains | Gene | WBGene00001067 | ||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| WBGene00017816 | ||||
| Variation | WBVar02153599 | |||
| Rearrangement | tmC18 | |||
| Transgene | WBTransgene00024753 | |||
| Properties | Outcrossed | x1 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 15 Mar 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous lethal deletion balanced by tmC18. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
| Species | Caenorhabditis elegans |
