WormBase Tree Display for Variation: WBVar02151635

WBVar02151635 Name: Public_name: tm11295
  Sequence_details: SMap: S_parent: Sequence: Y38E10A
    Flanking_sequences: ttagagaaaatttcagctctttttacattt cccgatttcgaatgtccttgaaattaaagg
    Mapping_target: Y38E10A
    Source_location: 7 CHROMOSOME_II 12588943 12604586 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11295_external
      tm11295_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11295
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012585
      WBGene00012584
    Transcript: Y38E10A.6b.1
      Y38E10A.7.1
      Y38E10A.6a.1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Remark: 19066/19067-34708/34709 (15642 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele