WormBase Tree Display for Variation: WBVar02121309
expand all nodes | collapse all nodes | view schema
WBVar02121309 | Name | Public_name | WBVar02121309 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852232 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | ||||
Flanking_sequences | CGATTTTCAAAAGCAATATCGGAGTGGAAA | TCCTACTGCTGGAACTGCAGGGACATTTGG | ||||||
Mapping_target | Y59A8B | |||||||
Source_location | 225 | CHROMOSOME_V | 18000001 | 18010000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004602 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00013352 | ||||||
WBGene00013351 | ||||||||
WBGene00045459 | ||||||||
Transcript | Y59A8B.26a.1 | |||||||
Y59A8B.19.1 | ||||||||
Y59A8B.20.1 | ||||||||
Y59A8B.26b.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |