WormBase Tree Display for Variation: WBVar00313433
expand all nodes | collapse all nodes | view schema
WBVar00313433 | Evidence | Paper_evidence | WBPaper00036201 | ||
---|---|---|---|---|---|
Name | Public_name | otn16612 | |||
Other_name | OH9305_136635 | ||||
Y59A8B.21a.1:c.690+395T>C | |||||
Y59A8B.21b.1:c.691-69T>C | |||||
HGVSg | CHROMOSOME_V:g.17989192T>C | ||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | |
Flanking_sequences | TGGCCTAGTTTACCCAATTCTAGTACATCTGCCAAGCGTGGCCTAGAAAA | CCTCGCGGCCACCATTTCCCTCTCTGTGGCCTAACTTTCAAAAACCTCGG | |||
Mapping_target | Y59A8B | ||||
Type_of_mutation | Substitution | T | C | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00029567 | ||||
Laboratory | OTN | ||||
Analysis | WGS_Hobert | ||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00013353 | |||
Transcript | Y59A8B.21a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | Y59A8B.21a.1:c.690+395T>C | ||||
Intron_number | 6/11 | ||||
Y59A8B.21b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | Y59A8B.21b.1:c.691-69T>C | ||||
Intron_number | 6/11 | ||||
Genetics | Map | V | |||
Reference | WBPaper00036201 | ||||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf268099 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Method | WGS_Hobert |