WormBase Tree Display for Variation: WBVar00296780
expand all nodes | collapse all nodes | view schema
| WBVar00296780 | Evidence | Paper_evidence | WBPaper00037686 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e2979 | |||||
| Other_name | JC8.12a.1:c.33-1G>A | ||||||
| HGVSg | CHROMOSOME_IV:g.13256836G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | JC8 | |||
| Flanking_sequences | tttaatttaaaaaaaaaatacaaattttca | catgatagtcttcgtcgctgcatccgtatt | |||||
| Mapping_target | JC8 | ||||||
| Type_of_mutation | Substitution | g | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00010442 | |||||
| Transcript | JC8.12a.1 | VEP_consequence | splice_acceptor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | JC8.12a.1:c.33-1G>A | ||||||
| Intron_number | 1/8 | ||||||
| Genetics | Interpolated_map_position | IV | 8.50333 | ||||
| Description | Phenotype | WBPhenotype:0001413 | Paper_evidence | WBPaper00037686 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | The Bus phenotype is more similar to br5 than to e2740. | Paper_evidence | WBPaper00037686 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00037686 | ||||||
| Method | Substitution_allele |
