WormBase Tree Display for Variation: WBVar00296780
expand all nodes | collapse all nodes | view schema
WBVar00296780 | Evidence | Paper_evidence | WBPaper00037686 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e2979 | |||||
Other_name | JC8.12a.1:c.33-1G>A | ||||||
HGVSg | CHROMOSOME_IV:g.13256836G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | |||
Flanking_sequences | tttaatttaaaaaaaaaatacaaattttca | catgatagtcttcgtcgctgcatccgtatt | |||||
Mapping_target | JC8 | ||||||
Type_of_mutation | Substitution | g | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (3) | |||||||
Affects | Gene | WBGene00010442 | |||||
Transcript | JC8.12a.1 | VEP_consequence | splice_acceptor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | JC8.12a.1:c.33-1G>A | ||||||
Intron_number | 1/8 | ||||||
Genetics | Interpolated_map_position | IV | 8.50333 | ||||
Description | Phenotype | WBPhenotype:0001413 | Paper_evidence | WBPaper00037686 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | The Bus phenotype is more similar to br5 than to e2740. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00037686 | ||||||
Method | Substitution_allele |