WormBase Tree Display for Variation: WBVar00277152
expand all nodes | collapse all nodes | view schema
WBVar00277152 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2435 | |||
Other_name | T01D3.3a.1:c.220+1105A>G | ||||
T01D3.2.1:c.429+74T>C | |||||
T01D3.3c.1:c.223+1105A>G | |||||
T01D3.3b.1:c.380-783A>G | |||||
HGVSg | CHROMOSOME_V:g.13706759A>G | ||||
Sequence_details | SMap | S_parent | Sequence | T01D3 | |
Flanking_sequences | CTGTAAGCTTAAACTTCTTTCCATACTTGATTTCAGGATGTTTTTGTGAA | GTTCAAAACTTGTAACTATAATAAAATATTTTTCCTGAATTTAATTATGT | |||
Mapping_target | T01D3 | ||||
Type_of_mutation | Substitution | A | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037339 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00011328 | |||
WBGene00011327 | |||||
Transcript | T01D3.3c.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | T01D3.3c.1:c.223+1105A>G | ||||
Intron_number | 3/9 | ||||
T01D3.3b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T01D3.3b.1:c.380-783A>G | ||||
Intron_number | 4/13 | ||||
T01D3.2.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T01D3.2.1:c.429+74T>C | ||||
Intron_number | 4/5 | ||||
T01D3.3a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T01D3.3a.1:c.220+1105A>G | ||||
Intron_number | 2/8 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf267807 | |||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |