WormBase Tree Display for Variation: WBVar00275299

WBVar00275299 Evidence: Paper_evidence: WBPaper00006355
  Name: Public_name: y47
    Other_name: CE26205:p.Gln1396Ter
      Y59A8B.1a.1:c.4186C>T
    HGVSg: CHROMOSOME_V:g.17939620G>A
  Sequence_details: SMap: S_parent: Sequence: Y59A8B
    Flanking_sequences: attatgccgtggggtgatttttcggaagtt agggtataaaagaggacacttcggacgatg
    Mapping_target: Y59A8B
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00035092
    Laboratory: TY
    Status: Live
  Affects: Gene: WBGene00001080
    Transcript: Y59A8B.1a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y59A8B.1a.1:c.4186C>T
        HGVSp: CE26205:p.Gln1396Ter
        cDNA_position: 4351
        CDS_position: 4186
        Protein_position: 1396
        Exon_number: 9/13
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
    Interactor: WBInteraction000052067
      WBInteraction000052434
  Genetics: Interpolated_map_position: V 13.3321
    Mapping_data: In_pos_neg_data: 4305
  Description: Phenotype: WBPhenotype:0000006 Paper_evidence: WBPaper00001077
        Curator_confirmed: WBPerson712
        Remark: Slightly Egl. Paper_evidence: WBPaper00001077
            Curator_confirmed: WBPerson712
      WBPhenotype:0000066 Paper_evidence: WBPaper00001077
        Curator_confirmed: WBPerson712
        Remark: 85% XX viable. Paper_evidence: WBPaper00001077
            Curator_confirmed: WBPerson712
      WBPhenotype:0000583 Paper_evidence: WBPaper00001077
          WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: XX animals are dumpy. Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
      WBPhenotype:0000718 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: As determined by the penetrance of the lin-14(n179) mutant phenotype, based on the [# mutant seam cell nuclei (undivided seam cell nuclei + nuclei that generated precocious alae)/ total # seam cell nuclei] animals after the L3 molt. Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Temperature: 24 Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
      WBPhenotype:0001581 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: Animals have 21%(n=20) mutant seam cell nuclei, similar to XXX lin-14 animals (26% n=25) and less mutant than XX lin-14 animals (77% n=40). Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006913 PATO:0000460 Paper_evidence: WBPaper00001011
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000035 PATO:0000460 Paper_evidence: WBPaper00001011
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Temperature: 24 Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
      WBPhenotype:0001582 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: XO lin-14(n179) males display significantly more lin-14 seam cell defects than lin-14 animals alone but similar to levels observed for lin-14/Df animals. Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 20 Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Genotype: lin-14(n179) Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
      WBPhenotype:0001583 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: XXX and XXXX progeny are lethal. Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000065 Paper_evidence: WBPaper00001077
        Curator_confirmed: WBPerson712
  Reference: WBPaper00013841
    WBPaper00001077
    WBPaper00001011
  Method: Substitution_allele