WormBase Tree Display for Variation: WBVar00254852

WBVar00254852 Name: Public_name: ttTi5439
  Sequence_details: SMap: S_parent: Sequence: Y51H1A
    Flanking_sequences: AGCATCGACAGTCGCTTCGGGACCACTTTT ATCGAAAGAATCAAAGGACAAAATTCAGCG
    Mapping_target: Y51H1A
    Type_of_mutation: Insertion
    SeqStatus: Sequenced
  Variation_type: Allele
    Transposon_insertion: Mos
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00010348
    Laboratory: IE
    Person: WBPerson6564
    DB_info: Database: NemaGENETAG_Consortium allele_name ttTi5439
    NemaGENETAG_consortium_allele
    Status: Live
  Affects: Gene: WBGene00013095
    Transcript: Y51H1A.4.1
  Description: Phenotype: WBPhenotype:0000002 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit a weak kinker Unc phenotype. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Penetrance: Complete: Paper_evidence: WBPaper00032356
              Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
      WBPhenotype:0000711 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: IR induced embryonic death was increased compared to wild-type animals, based on the number of unhatched embryos among the brood laid 8-12 hours following exposure of adults to 120 Gy of IR. Embryonic death was less severe than in tm2530 animals. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were assayed over IR doses of 0-240 Gy. Paper_evidence: WBPaper00032356
              Curator_confirmed: WBPerson712
      WBPhenotype:0001410 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Endogenous ING-3 was absent in animals as assayed by loss of a single 45 kDa band on western blots recognized by mouse polyclonal anti-ING-3. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
      WBPhenotype:0002541 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited decreased levels of IR-induced germ cell apoptosis. The number of germ cell corpses was half that of wild type following radiation. Allele strength: tm2530>ttTi5439. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00032356
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Cell corpses per gonad arm were assayed for at 0, 12, 24, and 36 hours post IR (Gy) treatment of L4 stage larvae or 24 hours after exposure to 120 Gy of IR. Paper_evidence: WBPaper00032356
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000730 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Animals displayed normal baseline germ cell death. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005175 PATO:0000460 Paper_evidence: WBPaper00032356
                Curator_confirmed: WBPerson712
  Reference: WBPaper00040752
    WBPaper00028894
    WBPaper00033043
    WBPaper00032356
  Remark: [20060613 ls] the TA insertion site may be +/- 10bp from this location
    [20060613 ls] the left side of Mos is facing the left of the sequence (to be confirmed).
    [20060613 ls] this MOS insertion generated thanks to a grant of the European Union (project NEMAGENETAG)
    For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
  Method: NemaGENETAG_consortium_allele