WormBase Tree Display for Sequence: Y51H1A
expand all nodes | collapse all nodes | view schema
Y51H1A | DNA | Y51H1A | 43667 | |||
---|---|---|---|---|---|---|
SMap | S_child | Gene_child | WBGene00013094 | 15942 | 18385 | |
WBGene00013096 | 31617 | 41536 | ||||
WBGene00013095 | 19107 | 25658 | ||||
WBGene00001838 | 25778 | 31107 | ||||
CDS_child (212) | ||||||
Transcript | Y51H1A.3a.1 | 15942 | 18373 | |||
Y51H1A.3b.1 | 15975 | 18385 | ||||
Y51H1A.4.1 | 19107 | 25658 | ||||
Y51H1A.5.1 | 25778 | 31107 | ||||
Y51H1A.6a.1 | 31617 | 41536 | ||||
Y51H1A.6b.1 | 39215 | 41232 | ||||
PCR_product (24) | ||||||
Allele (1531) | ||||||
Oligo_set | Aff_W02B8.1 | 43777 | 41614 | |||
Aff_Y51H1A.2 | 7130 | 5712 | ||||
Aff_Y51H1A.3A | 15944 | 18291 | ||||
Aff_Y51H1A.3B | 16023 | 18291 | ||||
Aff_Y51H1A.4 | 22644 | 25337 | ||||
Aff_Y51H1A.5 | 29744 | 31018 | ||||
Aff_Y51H1A.6 | 35524 | 37074 | ||||
Aff_Y51H1A.7 | 39394 | 41231 | ||||
Feature_object (375) | ||||||
Feature_data | Y51H1A:Polysome | 1 | 43667 | |||
Y51H1A:TranscriptionallyActiveRegion | 1 | 43667 | ||||
Y51H1A:ChIPSeqTF | 1 | 43667 | ||||
Y51H1A:TRF | 1 | 43667 | ||||
Y51H1A:Dust | 1 | 43667 | ||||
Y51H1A:inverted | 1 | 43667 | ||||
Homol_data (20) | ||||||
Structure | From | Source | CHROMOSOME_II | |||
Overlap_right | W02B8 | 43568 | ||||
Overlap_left | F08G2 | |||||
Clone_left_end | W02B8 | 43568 | ||||
Y51H1A | 1 | |||||
Clone_right_end | F08G2 | 100 | ||||
DB_info | Database | EMBL | NDB_AC | AL032644 | ||
NDB_SV | AL032644.2 | |||||
Secondary_accession | Z92821 | |||||
DB_remark | [121025] Sequence correction WBsf268435 : Insertion T1 bases from @ 27073 | |||||
Keyword | HTG | |||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
Origin | From_author | Smye R | ||||
From_laboratory | HX | |||||
Date_directory | 980710 | |||||
Species | Caenorhabditis elegans | |||||
Strain | WBStrain00000001 | |||||
Visible | Clone | Y51H1A | ||||
Properties | Genomic_canonical | |||||
Checksum | MD5 | 6bf1d6121cc72b515ebf45d71f505f96 | ||||
Status | Finished | 10 Jul 1998 00:00:00 | ||||
Submitted | 29 Oct 1998 00:00:00 | |||||
Annotated | 01 Jan 1980 00:00:00 | |||||
Map | Sequence-II | Ends | Left | 7949 | ||
Right | 7995 | |||||
Interpolated_map_position | II | 20.6076 | ||||
Assembly_tags | Clone right end | 100 | 97 | F08G2 | ||
Finished Left | 1 | 4 | Y51H1A | |||
oligo | 7011 | 7027 | serial#=y51h1.01 template=tn75a9.r1t sequence=TGAAGCTGTACGGGTTC flags= | |||
9814 | 9830 | serial#=y51h1.03 template=tn76h6.f1l sequence=TCGGTAAAAACTTGGGC flags= | ||||
10775 | 10796 | serial#=y51h1.05 template=tm80d10.s1 sequence=CTACCAATTTTGGTCAATTTTG flags= tm52.6 | ||||
11433 | 11417 | serial#=y51h1.06 template=to18b9.f1 sequence=TACTAAAACCCCTCAGC flags= | ||||
17733 | 17749 | serial#=Y51H1.07 template=tp37f8.r1t sequence=GTCGGATTTTCCACAGG flags= | ||||
18466 | 18488 | serial#=Y51H1.16 template=tu61e6 sequence=CGCCTAATTGAAAAAAAAATTCC flags= | ||||
18937 | 18958 | serial#=y51h1.10 template=tu61e6.q1tU sequence=CGGAAATTCAAATAGGAATTAG flags= | ||||
19204 | 19183 | serial#=Y51H1.17 template=Y51H1b6 sequence=GTTTTTATAGGGGAAAAGTTTG flags= | ||||
20723 | 20743 | serial#=y51h1.08 template=tm78f7.r1t sequence=CAAAAATAGCTGAAAAATGGC flags= | ||||
20973 | 20989 | serial#=y51h1.12 template=to22b7.r2t sequence=ACAATTCAGGAGTGACC flags= | ||||
21416 | 21400 | serial#=y51h1.11 template=tp34a10.r1t sequence=TGGGCTCCAAATTTTGC flags= | ||||
22151 | 22129 | serial#=y51h1.13 template=tm80e11.r1t sequence=GTTTATTAAGGTCTGTTTAAAGC flags= | ||||
22510 | 22526 | serial#=Y51H1.14 template=tp33h11.r1t sequence=ACACAAATGCTCTCCGC flags= | ||||
22662 | 22678 | serial#=Y51H1.18 template=tn84f8 sequence=AGCCTACTGATGACACC flags= | ||||
23119 | 23101 | serial#=Y51H1.15 template=tm77d2.p1t sequence=CTAACATGACGATTATCAC flags= | ||||
23901 | 23922 | serial#=Y51H1.31 template=tm80h8 sequence=GAAAAATTTCACGAACATTCAG flags= | ||||
24424 | 24442 | serial#=Y51H1.30 template=to19f4 sequence=CATTTTTCGCACTGTTTTC flags= | ||||
24513 | 24493 | serial#=Y51H1.20 template=to23e10 sequence=GGTTTTTGGTGTAAATTTCAG flags= | ||||
24911 | 24894 | serial#=Y51H1.19 template=to23e10 sequence=AGACCATCACCAAAAAAC flags= | ||||
26951 | 26930 | serial#=Y51H1.19 template=tn75g12 sequence=CAAATCAGATTTCCAGAAAAAG flags= | ||||
30982 | 30965 | serial#=Y51H1.20 template=to22d11 sequence=AATATTCTTCATCTCCCC flags= | ||||
33158 | 33141 | serial#=Y51H1.21 template=tp33a3 sequence=AAATGTGGATTTTCAGGG flags= | ||||
32996 | 33018 | serial#=Y51H1.16 template=tp34a5.r1t sequence=CACGAAAAACACATAATTTCAAG flags= | ||||
33456 | 33439 | serial#=Y51H1.17 template=to18f12.r1t sequence=AAACTCGGGATTTTTAGC flags= | ||||
34481 | 34497 | serial#=Y51H1.18 sequence=TCGCAGCTTTTCGTGTG flags= | ||||
35170 | 35151 | serial#=Y51H1.15 template= sequence=GAATTACGGGAATACAAAAC flags= | ||||
35539 | 35556 | serial#=Y51H1.22 template=tm79f8 sequence=GACCAACACATTCACTAC flags= | ||||
36980 | 36964 | serial#=Y51H1.23 template=tm79f8 sequence=TCTTCTCCCGTCTCATC flags= | ||||
37253 | 37233 | serial#=Y51H1.22 template=tn76c8.f1 sequence=CAATTTTGCACTGAAAAATCG flags= | ||||
39118 | 39135 | serial#=Y51H1,21 template=to18e8.r1t sequence=AACAAAGTGATCGGAATC flags= | ||||
40172 | 40155 | serial#=y51h1.04 template=to18d11.q2t sequence=GTCTCACAGTGAAAATTG flags= tm50.5 could be priming elsewhere | ||||
40376 | 40360 | serial#=y51h1.02 template=to18d11.r1t sequence=GCGGAAAACCATAAGCC flags= | ||||
comment | 16000 | 16002 | retacking error trace is to23a6.q1ta | |||
16442 | 16444 | retracking error trace is to23a6.q1ta | ||||
17371 | 17372 | this is tp37f9.q1lta retracking error | ||||
19449 | 19451 | Retracking error trace is tn85g1.q1lta | ||||
30970 | 30971 | this is not clone tp32a1 shotgun ut | ||||
TeamLeader comment | 19645 | 19672 | 2453, 2452, 1182 poss all same clone, so 3500 extended | |||
29368 | 29370 | query - look at #3077 jes happy with CCCGGC | ||||
38786 | 39028 | [ ] Tandem repeat [X] Single clone region [ ] Forced join [ ] Other Comment annotation tag not needed. I've extended cut-off data | ||||
39466 | 39497 | [ ] Tandem repeat [X] Single clone region [ ] Forced join [ ] Other Comment | ||||
annotation | 34622 | 34962 | [ ] Tandem repeat [X] Single clone region [ ] Forced join [ ] Other Comment Region consisting solely of reads from a short insert library derived from a pUC clone. | |||
35017 | 35026 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - | ||||
Finished Right | 43664 | 43667 | Y51H1A | |||
Clone left end | 43568 | 43571 | W02B8 | |||
Method | Genomic_canonical |