WormBase Tree Display for Variation: WBVar00254852

WBVar00254852 Name: Public_name: ttTi5439
  Sequence_details: SMap: S_parent: Sequence: Y51H1A
    Flanking_sequences: AGCATCGACAGTCGCTTCGGGACCACTTTT ATCGAAAGAATCAAAGGACAAAATTCAGCG
    Mapping_target: Y51H1A
    Type_of_mutation: Insertion
    SeqStatus: Sequenced
  Variation_type: Allele
    Transposon_insertion: Mos
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00010348
    Laboratory: IE
    Person: WBPerson6564
    DB_info: Database: NemaGENETAG_Consortium allele_name ttTi5439
    NemaGENETAG_consortium_allele
    Status: Live
  Affects: Gene: WBGene00013095
    Transcript: Y51H1A.4.1
  Description: Phenotype (4)
    Phenotype_not_observed: WBPhenotype:0000730 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Animals displayed normal baseline germ cell death. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005175 PATO:0000460 Paper_evidence: WBPaper00032356
                Curator_confirmed: WBPerson712
  Reference: WBPaper00040752
    WBPaper00028894
    WBPaper00033043
    WBPaper00032356
  Remark: [20060613 ls] the TA insertion site may be +/- 10bp from this location
    [20060613 ls] the left side of Mos is facing the left of the sequence (to be confirmed).
    [20060613 ls] this MOS insertion generated thanks to a grant of the European Union (project NEMAGENETAG)
    For further information and strain requests please visit http://ums3421.univ-lyon1.fr/
  Method: NemaGENETAG_consortium_allele