WormBase Tree Display for Variation: WBVar00249549

WBVar00249549 Name: Public_name: tm508
    Other_name: C09G12.1.1:c.519+116_*24del
    HGVSg: CHROMOSOME_IV:g.3503417_3503867del
  Sequence_details: SMap: S_parent: Sequence: C09G12
    Flanking_sequences: caaaatttcagctactcggaaaatccaaaa attattaattagaaattgaattggaataat
    Mapping_target: C09G12
    Source_location: 7 CHROMOSOME_IV 3503416 3503868 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm508_external
      tm508_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 508
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015651
    Transcript: C09G12.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C09G12.1.1:c.519+116_*24del
        cDNA_position: ?-695
        Intron_number: 5/6
        Exon_number: 6-7/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000002 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: kinker/omega. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000551 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: kinker/omega. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 30116/30117-30567/30568 (451 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele