WormBase Tree Display for Variation: WBVar00249549
expand all nodes | collapse all nodes | view schema
WBVar00249549 | Name | Public_name | tm508 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C09G12.1.1:c.519+116_*24del | |||||||
HGVSg | CHROMOSOME_IV:g.3503417_3503867del | |||||||
Sequence_details | SMap | S_parent | Sequence | C09G12 | ||||
Flanking_sequences | caaaatttcagctactcggaaaatccaaaa | attattaattagaaattgaattggaataat | ||||||
Mapping_target | C09G12 | |||||||
Source_location | 7 | CHROMOSOME_IV | 3503416 | 3503868 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm508_external | |||||||
tm508_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 508 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015651 | ||||||
Transcript | C09G12.1.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C09G12.1.1:c.519+116_*24del | |||||||
cDNA_position | ?-695 | |||||||
Intron_number | 5/6 | |||||||
Exon_number | 6-7/7 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: kinker/omega. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000551 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: kinker/omega. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |