WormBase Tree Display for Variation: WBVar00249549
expand all nodes | collapse all nodes | view schema
WBVar00249549 | Name | Public_name | tm508 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C09G12.1.1:c.519+116_*24del | |||||||
HGVSg | CHROMOSOME_IV:g.3503417_3503867del | |||||||
Sequence_details | SMap | S_parent | Sequence | C09G12 | ||||
Flanking_sequences | caaaatttcagctactcggaaaatccaaaa | attattaattagaaattgaattggaataat | ||||||
Mapping_target | C09G12 | |||||||
Source_location | 7 | CHROMOSOME_IV | 3503416 | 3503868 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm508_external | |||||||
tm508_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 508 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects (2) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: kinker/omega. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000551 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: kinker/omega. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 30116/30117-30567/30568 (451 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |