WormBase Tree Display for Variation: WBVar00249040
expand all nodes | collapse all nodes | view schema
| WBVar00249040 | Evidence | Paper_evidence | WBPaper00035599 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | sy700 | |||||
| Other_name | CE05731:p.Lys308HisfsTer3 | ||||||
| F25H8.6.1:c.919_1283del | |||||||
| HGVSg | CHROMOSOME_IV:g.9919497_9919910del | ||||||
| Sequence_details | SMap | S_parent | Sequence | F25H8 | |||
| Flanking_sequences | CCAACAGACGTTGAGGAGGAGGATCTTGAA | caggtcagtctctaacaaaaactcaa | |||||
| Mapping_target | F25H8 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | PS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00009133 | |||||
| Transcript | F25H8.6.1 (11) | ||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00035599 | |||
| Genetics | Interpolated_map_position | IV | 4.44687 | ||||
| Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00035599 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | bed-3 mutations caused an Egl (egg-laying defective) phenotype | Paper_evidence | WBPaper00035599 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0000052 | Paper_evidence | WBPaper00035599 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Maternal effect embryonic lethality | Paper_evidence | WBPaper00035599 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Maternal | |||||||
| WBPhenotype:0000239 | Paper_evidence | WBPaper00035599 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Granddaughters of P5.p, P6.p and P7.p often failed to divide in bed-3 mutants | Paper_evidence | WBPaper00035599 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00035599 | ||||||
| Method | Deletion_allele |
