WormBase Tree Display for Variation: WBVar00249040
expand all nodes | collapse all nodes | view schema
WBVar00249040 | Evidence | Paper_evidence | WBPaper00035599 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy700 | |||||
Other_name | CE05731:p.Lys308HisfsTer3 | ||||||
F25H8.6.1:c.919_1283del | |||||||
HGVSg | CHROMOSOME_IV:g.9919497_9919910del | ||||||
Sequence_details | SMap | S_parent | Sequence | F25H8 | |||
Flanking_sequences | CCAACAGACGTTGAGGAGGAGGATCTTGAA | caggtcagtctctaacaaaaactcaa | |||||
Mapping_target | F25H8 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects (2) | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00035599 | |||
Genetics | Interpolated_map_position | IV | 4.44687 | ||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00035599 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | bed-3 mutations caused an Egl (egg-laying defective) phenotype | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000052 | Paper_evidence | WBPaper00035599 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Maternal effect embryonic lethality | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Maternal | |||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00035599 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Granddaughters of P5.p, P6.p and P7.p often failed to divide in bed-3 mutants | Paper_evidence | WBPaper00035599 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00035599 | ||||||
Method | Deletion_allele |