WormBase Tree Display for Variation: WBVar00248955
expand all nodes | collapse all nodes | view schema
WBVar00248955 | Evidence | Paper_evidence | WBPaper00005610 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00006052 | |||||||||
Name | Public_name | sy275 | |||||||
Other_name | R03C1.3b.1:c.127T>A | ||||||||
R03C1.3a.1:c.577T>A | |||||||||
CE33290:p.Tyr43Asn | |||||||||
CE25964:p.Tyr193Asn | |||||||||
HGVSg | CHROMOSOME_II:g.14904936T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R03C1 | |||||
Flanking_sequences | cagctggagcggaagttcgagcaaaccaag | acctagccggagcagatcgtgcacagctcg | |||||||
Mapping_target | R03C1 | ||||||||
Type_of_mutation | Substitution | t | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030864 | ||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000584 | |||||||
Transcript | R03C1.3b.1 (12) | ||||||||
R03C1.3a.1 (12) | |||||||||
Interactor (11) | |||||||||
Genetics | Interpolated_map_position | II | 23.6957 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00005610 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | vulF precursors fail to divide. Poor separation of vulF cells | Paper_evidence | WBPaper00005610 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006768 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00005610 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000283 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000665 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | connection defect between vas deferens and proctodeum in 30% of the males | Paper_evidence | WBPaper00005610 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00005610 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | only 30% of homozygote males can mate | Paper_evidence | WBPaper00005610 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00005610 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00005610 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00025135 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that in the mid-L4 stage, cog-1(sy275) caused ectopic expression of egl-17 in vulE cells (Fig. 2) and ectopic expression of ceh-2 in vulC, vulD, and vulE cells and loss of zmp-1 expression in vulE cells." | Paper_evidence | WBPaper00025135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006767 | PATO:0000460 | Paper_evidence | WBPaper00025135 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006765 | PATO:0000460 | Paper_evidence | WBPaper00025135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006766 | PATO:0000460 | Paper_evidence | WBPaper00025135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00025135 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | ayIs4 [egl-17::GFP] | Paper_evidence | WBPaper00025135 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
syIs54 [ceh-2::gfp] | Paper_evidence | WBPaper00025135 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001376 | Paper_evidence | WBPaper00025135 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that in the mid-L4 stage, cog-1(sy275) caused ectopic expression of egl-17 in vulE cells (Fig. 2) and ectopic expression of ceh-2 in vulC, vulD, and vulE cells and loss of zmp-1 expression in vulE cells." (also Table 1) | Paper_evidence | WBPaper00025135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006767 | PATO:0000460 | Paper_evidence | WBPaper00025135 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00025135 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | syIs49 [zmp-1::gfp] | Paper_evidence | WBPaper00025135 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001511 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005062 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00005610 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00005610 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ASE asymmetry is mildly disrupted (as seen with lim-6 reporters). 2 ASEL | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 4 | 4 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005663 | PATO:0000460 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs6, otIs114 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00006052 | ||||||||
WBPaper00025135 | |||||||||
WBPaper00017759 | |||||||||
WBPaper00005610 | |||||||||
WBPaper00017166 | |||||||||
WBPaper00014977 | |||||||||
WBPaper00015092 | |||||||||
Method | Substitution_allele |