WormBase Tree Display for Variation: WBVar00248702
expand all nodes | collapse all nodes | view schema
| WBVar00248702 | Name | Public_name | st15 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | CE13148:p.Tyr144Asn | ||||||
| T04C12.6.1:c.430T>A | |||||||
| HGVSg | CHROMOSOME_V:g.11081550T>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | T04C12 | |||
| Flanking_sequences | tatgtcgccatccaagctgtcctctccctc | acgcttccggacgtaccaccggagtcgtcc | |||||
| Mapping_target | T04C12 | ||||||
| Type_of_mutation | Substitution | t | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00033488 | ||||||
| Laboratory | RW | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000063 | |||||
| Transcript | T04C12.6.1 (11) | ||||||
| Genetics | Interpolated_map_position | V | 2.9447 | ||||
| Mapping_data | In_multi_point | 228 | |||||
| 229 | |||||||
| 262 | |||||||
| 266 | |||||||
| 448 | |||||||
| 547 | |||||||
| Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00000741 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | both st15 and st15/+ are slow-growing | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00000741 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES3_Easy_to_score | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000229 | Paper_evidence | WBPaper00000741 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | both st15 and st15/+ are small | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00000741 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES3_Easy_to_score | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000781 | Paper_evidence | WBPaper00000741 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | both st15 and st15/+ have abnormal thin filament ultrastructure in muscle | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00000741 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001213 | Paper_evidence | WBPaper00000741 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | both st15 and st15/+ uncoordinated almost paralysed | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00000741 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES3_Easy_to_score | Paper_evidence | WBPaper00000741 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00015980 | ||||||
| WBPaper00016043 | |||||||
| WBPaper00016109 | |||||||
| WBPaper00000741 | |||||||
| Method | Substitution_allele |
