WormBase Tree Display for Variation: WBVar00248702
expand all nodes | collapse all nodes | view schema
WBVar00248702 | Name | Public_name | st15 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE13148:p.Tyr144Asn | ||||||
T04C12.6.1:c.430T>A | |||||||
HGVSg | CHROMOSOME_V:g.11081550T>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T04C12 | |||
Flanking_sequences | tatgtcgccatccaagctgtcctctccctc | acgcttccggacgtaccaccggagtcgtcc | |||||
Mapping_target | T04C12 | ||||||
Type_of_mutation | Substitution | t | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00033488 | ||||||
Laboratory | RW | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000063 | |||||
Transcript | T04C12.6.1 (11) | ||||||
Genetics | Interpolated_map_position | V | 2.9447 | ||||
Mapping_data | In_multi_point | 228 | |||||
229 | |||||||
262 | |||||||
266 | |||||||
448 | |||||||
547 | |||||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00000741 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | both st15 and st15/+ are slow-growing | Paper_evidence | WBPaper00000741 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00000741 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Neomorph_gain_of_function (2) | ||||||
Ease_of_scoring | ES3_Easy_to_score | Paper_evidence | WBPaper00000741 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00000741 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | both st15 and st15/+ are small | Paper_evidence | WBPaper00000741 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00000741 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Neomorph_gain_of_function (2) | ||||||
Ease_of_scoring | ES3_Easy_to_score | Paper_evidence | WBPaper00000741 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000781 | Paper_evidence | WBPaper00000741 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | both st15 and st15/+ have abnormal thin filament ultrastructure in muscle | Paper_evidence | WBPaper00000741 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00000741 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Neomorph_gain_of_function (2) | ||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00000741 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | both st15 and st15/+ uncoordinated almost paralysed | Paper_evidence | WBPaper00000741 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00000741 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Neomorph_gain_of_function (2) | ||||||
Ease_of_scoring | ES3_Easy_to_score | Paper_evidence | WBPaper00000741 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00015980 | ||||||
WBPaper00016043 | |||||||
WBPaper00016109 | |||||||
WBPaper00000741 | |||||||
Method | Substitution_allele |