WormBase Tree Display for Variation: WBVar00239230

WBVar00239230 Evidence: Paper_evidence: WBPaper00002619
  Name: Public_name: pk89
    Other_name: pk89te
      F57C12.5d.1:c.1886_3241-649del
      F57C12.5c.1:c.1886_3392del
      CE31189:p.Asp629AlafsTer2
      F57C12.5e.1:c.1886_3396+587del
      F57C12.5b.2:c.1886_3241-159del
      F57C12.5b.1:c.1886_3241-159del
    HGVSg: CHROMOSOME_X:g.580302_583514del
  Sequence_details: SMap: S_parent: Sequence: F57C12
    Flanking_sequences: TGCTATCAAAATGGACGGTGGGTCATTTGCTTGGGGATCTAAGGAAGAAG CTTGGTACGACTATAACCACCACTTTGCATGGTTGTGTTTTTAAAACTTC
    Mapping_target: F57C12
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004730
      WBStrain00028890
      WBStrain00028891
      WBStrain00054655
      WBStrain00054656
      WBStrain00054657
    Laboratory: NL
    Expr_pattern: Expr16309
    Status: Live: Curator_confirmed: WBPerson4025
  Affects: Gene: WBGene00003407
    Transcript: F57C12.5d.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F57C12.5d.1:c.1886_3241-649del
        cDNA_position: 1961-?
        CDS_position: 1886-?
        Protein_position: 629-?
        Intron_number: 9-13/21
        Exon_number: 9-13/22
      F57C12.5b.2 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F57C12.5b.2:c.1886_3241-159del
        cDNA_position: 2226-?
        CDS_position: 1886-?
        Protein_position: 629-?
        Intron_number: 10-14/22
        Exon_number: 10-14/23
      F57C12.5c.1 (11)
      F57C12.5e.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F57C12.5e.1:c.1886_3396+587del
        cDNA_position: 1967-?
        CDS_position: 1886-?
        Protein_position: 629-?
        Intron_number: 9-14/21
        Exon_number: 9-14/22
      F57C12.5b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F57C12.5b.1:c.1886_3241-159del
        cDNA_position: 1955-?
        CDS_position: 1886-?
        Protein_position: 629-?
        Intron_number: 9-13/21
        Exon_number: 9-13/22
  Genetics: Interpolated_map_position: X -19.6068
    Mapping_data: In_multi_point: 4495
  Description: Phenotype: WBPhenotype:0001208 Paper_evidence: WBPaper00027644
        Curator_confirmed: WBPerson557
        Remark: Animals resistant to RNAi of pop-1, but not unc-22. Authors note cold sensitive for pop-1 RNAi. Paper_evidence: WBPaper00027644
            Curator_confirmed: WBPerson557
        Temperature_sensitive: Cold_sensitive: Paper_evidence: WBPaper00027644
              Curator_confirmed: WBPerson557
        Phenotype_assay: Treatment: Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. Paper_evidence: WBPaper00027644
              Curator_confirmed: WBPerson557
      WBPhenotype:0001655 Paper_evidence: WBPaper00002619
        Curator_confirmed: WBPerson2987
        Remark: Wild-type N2 animals have an EC50 for cadmium chloride of 70 μM, whereas the mrp-1(pk89) mutant animals have an EC50 of 45 μM (Figure 5A). At the concentration of 60 μM cadmium chloride, none of the mrp-1(pk89) mutant animals survived the exposure whereas 75% of the wild-type animals still developed. mrp-1(pk89) mutant animals also exhibited a cadmium hypersensitivity in a recovery assay (Figure 6A). Paper_evidence: WBPaper00002619
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00003022 Paper_evidence: WBPaper00002619
              Curator_confirmed: WBPerson2987
      WBPhenotype:0002218 Paper_evidence: WBPaper00002619
        Curator_confirmed: WBPerson2987
        Remark: With sodium arsenite, wild-type animals had an EC50 of 1.5 - 1.6 millimolar and the mrp-1(pk89) mutant animals had an EC50 of 1.2 millimolar (Figure 5B), while at that same concentration almost 90% of the wild-type animals developed. mrp-1(pk89) mutant animals also exhibited an arsenite hypersensitivity in a recovery assay (Figure 6B). Paper_evidence: WBPaper00002619
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00004596 Paper_evidence: WBPaper00002619
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000486 Paper_evidence: WBPaper00002619
        Curator_confirmed: WBPerson2987
        Remark: data not shown Paper_evidence: WBPaper00002619
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000520 Paper_evidence: WBPaper00002619
        Curator_confirmed: WBPerson712
        Remark: Under standard laboratory conditions, the mrp-1 mutant is phenotypically wild-type. Paper_evidence: WBPaper00002619
            Curator_confirmed: WBPerson712
      WBPhenotype:0002217 Paper_evidence: WBPaper00002619
        Curator_confirmed: WBPerson2987
        Remark: data not shown Paper_evidence: WBPaper00002619
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00001356 Paper_evidence: WBPaper00002619
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00027644
    WBPaper00002619
  Remark: This was suppressed because it overlapped with a corrected genome sequence error feature Feature_evidence: WBsf267836
    This was un-suppressed after examination showed it is not changed by the corrected genome sequence error Curator_confirmed: WBPerson4025
  Method: Deletion_allele