WormBase Tree Display for Variation: WBVar00239230
expand all nodes | collapse all nodes | view schema
WBVar00239230 | Evidence | Paper_evidence | WBPaper00002619 | ||
---|---|---|---|---|---|
Name | Public_name | pk89 | |||
Other_name | pk89te | ||||
F57C12.5d.1:c.1886_3241-649del | |||||
F57C12.5c.1:c.1886_3392del | |||||
CE31189:p.Asp629AlafsTer2 | |||||
F57C12.5e.1:c.1886_3396+587del | |||||
F57C12.5b.2:c.1886_3241-159del | |||||
F57C12.5b.1:c.1886_3241-159del | |||||
HGVSg | CHROMOSOME_X:g.580302_583514del | ||||
Sequence_details | SMap | S_parent | Sequence | F57C12 | |
Flanking_sequences | TGCTATCAAAATGGACGGTGGGTCATTTGCTTGGGGATCTAAGGAAGAAG | CTTGGTACGACTATAACCACCACTTTGCATGGTTGTGTTTTTAAAACTTC | |||
Mapping_target | F57C12 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004730 | ||||
WBStrain00028890 | |||||
WBStrain00028891 | |||||
WBStrain00054655 | |||||
WBStrain00054656 | |||||
WBStrain00054657 | |||||
Laboratory | NL | ||||
Expr_pattern | Expr16309 | ||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00003407 | |||
Transcript | F57C12.5d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | F57C12.5d.1:c.1886_3241-649del | ||||
cDNA_position | 1961-? | ||||
CDS_position | 1886-? | ||||
Protein_position | 629-? | ||||
Intron_number | 9-13/21 | ||||
Exon_number | 9-13/22 | ||||
F57C12.5b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F57C12.5b.2:c.1886_3241-159del | ||||
cDNA_position | 2226-? | ||||
CDS_position | 1886-? | ||||
Protein_position | 629-? | ||||
Intron_number | 10-14/22 | ||||
Exon_number | 10-14/23 | ||||
F57C12.5c.1 (11) | |||||
F57C12.5e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F57C12.5e.1:c.1886_3396+587del | ||||
cDNA_position | 1967-? | ||||
CDS_position | 1886-? | ||||
Protein_position | 629-? | ||||
Intron_number | 9-14/21 | ||||
Exon_number | 9-14/22 | ||||
F57C12.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F57C12.5b.1:c.1886_3241-159del | ||||
cDNA_position | 1955-? | ||||
CDS_position | 1886-? | ||||
Protein_position | 629-? | ||||
Intron_number | 9-13/21 | ||||
Exon_number | 9-13/22 | ||||
Genetics | Interpolated_map_position | X | -19.6068 | ||
Mapping_data | In_multi_point | 4495 | |||
Description (2) | |||||
Reference | WBPaper00027644 | ||||
WBPaper00002619 | |||||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf267836 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Method | Deletion_allele |