WormBase Tree Display for Variation: WBVar00145853
expand all nodes | collapse all nodes | view schema
WBVar00145853 | Evidence | Paper_evidence | WBPaper00035654 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gk448 | |||||||
HGVSg | CHROMOSOME_III:g.13771453_13771807del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K08E3 | |||||
Flanking_sequences | caaggcctcgactagttttttgaatttaat | ttacttatataaataactggaattgttatt | |||||||
Mapping_target | K08E3 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | gk448_external | ||||||||
gk448_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036256 | ||||||||
Component_of_genotype | WBGenotype00000134 | ||||||||
WBGenotype00000135 | |||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003967 | |||||||
Transcript | K08E3.7b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2-3/6 | ||||||||
Exon_number | 1-3/7 | ||||||||
K08E3.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2-3/8 | ||||||||
Exon_number | 1-3/9 | ||||||||
K08E3.7c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 1/5 | ||||||||
Exon_number | 1/6 | ||||||||
K08E3.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2-3/7 | ||||||||
Exon_number | 1-3/8 | ||||||||
Interactor | WBInteraction000524464 | ||||||||
WBInteraction000524466 | |||||||||
WBInteraction000524468 | |||||||||
WBInteraction000532904 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00044740 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Gene expression data reveal inherently upregulated dat-1 mRNA levels. | Paper_evidence | WBPaper00044740 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001401 | Paper_evidence | WBPaper00047030 | |||||||
Curator_confirmed | WBPerson25433 | ||||||||
Remark | Highly fused mitochondrial networks measured in L4 stage nematodes | Paper_evidence | WBPaper00047030 | ||||||
Curator_confirmed | WBPerson25433 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00047030 | ||||
Curator_confirmed | WBPerson25433 | ||||||||
GO_term | GO:0005739 | PATO:0000642 | Paper_evidence | WBPaper00047030 | |||||
Curator_confirmed | WBPerson25433 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00035654 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 3 miRNAs were observed differentially expressed (p<0.05) in pdr-1 mutants when compared to N2 wt | Paper_evidence | WBPaper00035654 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002223 | Paper_evidence | WBPaper00044740 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pdr-1 mutants exhibited hypersensitivity to Mn-induced lethality (LD50 = 5.59 mM) compared to WT worms (LD50 = 10.43 mM) | Paper_evidence | WBPaper00044740 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002230 | Paper_evidence | WBPaper00044740 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Deletion mutants exhibited an enhanced Mn accumulation compared to WT worms. | Paper_evidence | WBPaper00044740 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002231 | Paper_evidence | WBPaper00044740 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In response to sub-lethal, acute Mn treatment (respective LD25), WT worms showed a time-dependent increase in Mn-induced RONS (reactive oxygen and nitrogen species) that was exacerbated in this mutant. | Paper_evidence | WBPaper00044740 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002430 | Paper_evidence | WBPaper00064562 | |||||||
Curator_confirmed | WBPerson440 | ||||||||
Phenotype_not_observed | WBPhenotype:0000140 | Paper_evidence | WBPaper00041209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | did not significantly exacerbate L3 arrest at any time point | Paper_evidence | WBPaper00041209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003513 | Paper_evidence | WBPaper00041209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00041209 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | serial ultraviolet C radiation(UVC) exposure (10 J/m2) | Paper_evidence | WBPaper00041209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info (2) | |||||||||
Reference | WBPaper00041209 | ||||||||
WBPaper00035654 | |||||||||
WBPaper00044740 | |||||||||
WBPaper00047030 | |||||||||
WBPaper00064979 | |||||||||
WBPaper00064562 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |