WormBase Tree Display for Sequence: K08E3

K08E3 DNA: K08E3 39565
  SMap: S_child (12)
  Structure: From: Source: CHROMOSOME_III
    Overlap_right: 3R5 39514
    Overlap_left: W06F12
    Clone_left_end: K08E3 1
    Clone_right_end: W06F12 467
      K08E3 39565
  DB_info: Database: EMBL NDB_AC Z81568
        NDB_SV Z81568.1
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: McMurray AA
    From_laboratory: HX
    Date_directory: 980708
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: K08E3
    Remark: Transposon K08E3.9 converted into an S_Child [020208 kj]
  Properties: Genomic_canonical
    Checksum: MD5: 1a8bf674fb68a7a0a74f1f61f9536ddb
    Status: Finished: 08 Jul 1998 00:00:00
      Submitted: 06 Nov 1996 00:00:00
      Annotated: 01 Jan 1980 00:00:00
  Map: Sequence-III Ends: Left: 6827
        Right: 6850
  Interpolated_map_position: III 21.4948
  Assembly_tags: cosmid vector 4 1 CAF:END=Left::loristB
      1 4 CAF:END=Left::loristB
      39565 39562 CAF:END=Right::loristB
      39562 39565 CAF:END=Right::loristB
    Finished Left 1 4 K08E3
    Clone left end 1 4 K08E3
    Clone right end 464 467 W06F12
      39562 39565 K08E3
    Finished Right 39562 39565 K08E3
    annotation 39318 39412 First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -single pUC18 clone in inverted repeatregion. Size of the region is confirmedby restriction digest
      9523 10344 tandem repeat region with typical repeat element GAGACTTTCGTGGTGAGACCTTTGTGGT (a 28-mer). Restriction digest shows that 130 bases of repeat region are missing from this assembly.
    repeat 8218 9517
      12290 13059
      13071 14139
    Inverted Repeat 35448 34676
      35519 36312
      38896 38790
      39374 39480
  Method: Genomic_canonical